Cd11B Biogenex Ivd Apprived

Lab Reagents

Biogenex Antibodies Laboratories manufactures the cd11b biogenex ivd apprived reagents distributed by Genprice. The Cd11B Biogenex Ivd Apprived reagent is RUO (Research Use Only) to test human serum or cell culture lab samples. To purchase these products, for the MSDS, Data Sheet, protocol, storage conditions/temperature or for the concentration, please contact BioGenex Antibodies. Other Cd11B products are available in stock. Specificity: Cd11B Category: Biogenex Group: Ivd Apprived

Ivd Apprived information


YF-PA12811 50 ug
EUR 363
Description: Mouse polyclonal to IVD


YF-PA12812 100 ug
EUR 403
Description: Rabbit polyclonal to IVD


11BA-100T 100 test
EUR 427


11BB-01MG 100 test
EUR 284


11BCFB-100T 100 test
EUR 388


11BF-100T 100 test
EUR 297


11BPE-100T 100 test
EUR 375


11BPP-100T 100 test
EUR 349


11BPU-01MG 0,1 mg
EUR 219

IVD cloning plasmid

CSB-CL011921HU-10ug 10ug
EUR 465
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1272
  • Sequence: atggcgactgcgactcggctgctggggtgtcgtgtggcgagctggaggctgcggccgccgcttgccggcttcgtttcccagcgggcccactcgcttttgcccgtggacgatgcaatcaatgggctaagcgaggagcagaggcagcttcgtcagaccatggctaagttccttcagg
  • Show more
Description: A cloning plasmid for the IVD gene.

anti- IVD antibody

FNab04426 100µg
EUR 505.25
  • Immunogen: isovaleryl Coenzyme A dehydrogenase
  • Uniprot ID: P26440
  • Gene ID: 3712
  • Research Area: Metabolism
Description: Antibody raised against IVD

anti- IVD antibody

FNab04427 100µg
EUR 585
  • Recommended dilution: WB: 1:1000-1:6000
  • IHC: 1:20-1:200
  • IF: 1:10-1:100
  • Immunogen: isovaleryl Coenzyme A dehydrogenase
  • Uniprot ID: P26440
  • Gene ID: 3712
  • Research Area: Metabolism
Description: Antibody raised against IVD

IVD Rabbit pAb

A15281-100ul 100 ul
EUR 308

IVD Rabbit pAb

A15281-200ul 200 ul
EUR 459

IVD Rabbit pAb

A15281-20ul 20 ul
EUR 183

IVD Rabbit pAb

A15281-50ul 50 ul
EUR 223

Human IVD Antibody

33170-05111 150 ug
EUR 261