Cytokines Elisa Ivd

Lab Reagents

Cytokine Elisa Laboratories manufactures the cytokines elisa ivd reagents distributed by Genprice. The Cytokines Elisa Ivd reagent is RUO (Research Use Only) to test human serum or cell culture lab samples. To purchase these products, for the MSDS, Data Sheet, protocol, storage conditions/temperature or for the concentration, please contact cytokine elisa. Other Cytokines products are available in stock. Specificity: Cytokines Category: Elisa Group: Ivd

Ivd information

IVD siRNA

20-abx920988
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

IVD siRNA

20-abx920989
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

IVD antibody

22140-100ul 100ul
EUR 390

IVD antibody

10R-4491 100 ul
EUR 691
Description: Mouse monoclonal IVD antibody

IVD antibody

70R-18039 50 ul
EUR 435
Description: Rabbit polyclonal IVD antibody

IVD antibody

70R-13603 100 ul
EUR 457
Description: Affinity purified Rabbit polyclonal IVD antibody

IVD Antibody

DF12284 200ul
EUR 304
Description: IVD antibody detects endogenous levels of IVD.

IVD Antibody

1-CSB-PA011921GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against IVD. Recognizes IVD from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC

IVD Antibody

1-CSB-PA011921LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against IVD. Recognizes IVD from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:500-1:1000

anti-IVD

YF-PA12811 50 ug
EUR 363
Description: Mouse polyclonal to IVD

anti-IVD

YF-PA12812 100 ug
EUR 403
Description: Rabbit polyclonal to IVD

IVD cloning plasmid

CSB-CL011921HU-10ug 10ug
EUR 465
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1272
  • Sequence: atggcgactgcgactcggctgctggggtgtcgtgtggcgagctggaggctgcggccgccgcttgccggcttcgtttcccagcgggcccactcgcttttgcccgtggacgatgcaatcaatgggctaagcgaggagcagaggcagcttcgtcagaccatggctaagttccttcagg
  • Show more
Description: A cloning plasmid for the IVD gene.

anti- IVD antibody

FNab04426 100µg
EUR 505.25
  • Immunogen: isovaleryl Coenzyme A dehydrogenase
  • Uniprot ID: P26440
  • Gene ID: 3712
  • Research Area: Metabolism
Description: Antibody raised against IVD

anti- IVD antibody

FNab04427 100µg
EUR 585
  • Recommended dilution: WB: 1:1000-1:6000
  • IHC: 1:20-1:200
  • IF: 1:10-1:100
  • Immunogen: isovaleryl Coenzyme A dehydrogenase
  • Uniprot ID: P26440
  • Gene ID: 3712
  • Research Area: Metabolism
Description: Antibody raised against IVD

IVD Rabbit pAb

A15281-100ul 100 ul
EUR 308

IVD Rabbit pAb

A15281-200ul 200 ul
EUR 459

IVD Rabbit pAb

A15281-20ul 20 ul
EUR 183