Fragment Screening for 14 Different Biologically Active RNAs and 10 DNA and protein counter-screens


19F-NMR-based fragment screening for 14 completely different biologically lively RNAs and 10 DNA and protein counter-screens


We report right here on the nuclear magnetic resonance (NMR) 19 F screening of 14 RNA targets with completely different secondary and tertiary construction to systematically assess druggability of RNAs. Our RNA targets embody consultant bacterial riboswitches that naturally bind with nanomolar affinity and excessive specificity to mobile metabolites of low molecular weight.
Primarily based on counter-screens in opposition to 5 DNAs and 5 proteins, we are able to present that RNA will be particularly focused. To reveal the standard of the preliminary fragment library that has been designed for simple follow-up chemistry, we additional present the best way to enhance binding affinity from an preliminary fragment hit by chemistry that hyperlinks the recognized fragment to the intercalator acridine. Thus, we obtain low micromolar binding affinity with out dropping binding specificity between two completely different terminator buildings.

Predicting persistence of atopic dermatitis in youngsters utilizing scientific attributes and serum proteins


Background: Atopic dermatitis (AD) is the commonest inflammatory pores and skin illness in youngsters, with 30% of all these identified creating power or relapsing illness by adolescence. Such illness persistence can’t but be predicted. The intention of the current research was to foretell the pure course of AD utilizing scientific parameters and serum proteins.
Strategies: Sera of 144 youngsters with AD (age 0-Three years) had been analyzed for IgE and 33 cytokines, chemokines, and development components. Affected person illness course till the age of seven years was assessed retrospectively. Unsupervised k-means clustering was carried out to outline illness endotypes.
Recognized components related to AD persistence on the age of seven years had been validated in youngsters with AD in an unbiased cohort (LISA Munich; n=168). Logistic regression and XGBoosting strategies adopted by cross-validation had been utilized to foretell particular person illness outcomes.
Outcomes: Three distinct endotypes had been present in infancy, characterised by a novel inflammatory signature. Elements related to illness persistence had been illness rating (SCORAD), involvement of the limbs, flexural lesion distribution on the age of three years, allergic comorbidities and illness exacerbation by the set off components stress, pollen publicity, and alter in climate.
Persistence was predicted with a sensitivity of 81.8% and a specificity of 82.4%. Elements with a excessive impression on the prediction of persistence had been SCORAD on the age of three years, set off components, and low VEGF serum ranges.
Conclusions: AD in infancy contains three immunological endotypes. Illness persistence will be predicted utilizing serum cytokines and scientific variables.


Active AHCY, human recombinant

EUR 262

Active AHCY, human recombinant

EUR 5482

Active AHCY, human recombinant

EUR 479

Active Recombinant Human CETP

EUR 805

Active Recombinant Human CETP

EUR 4345

Active Recombinant Human CETP

EUR 262

Active SIRT2, human recombinant

EUR 262

Active SIRT2, human recombinant

EUR 4394

Active SIRT2, human recombinant

EUR 457

Active SIRT7, human recombinant

EUR 218

Active SIRT7, human recombinant

EUR 588

Irisin, Active, human recombinant

EUR 370

Irisin, Active, human recombinant

EUR 1077

PRMT1, human recombinant (Active)

EUR 153

PRMT1, human recombinant (Active)

EUR 3834

PRMT1, human recombinant (Active)

EUR 392

GAPDH, Active, human recombinant

EUR 142

GAPDH, Active, human recombinant

EUR 392

Activin-A Human Recombinant Protein, Active

PROTP08476-2 Regular: 10ug
EUR 317
Description: Active form Activin-A Human Recombinant produced in e.coli is a homodimeric, non-glycosylated, polypeptide chain containing 2 x 117 amino acids and having a molecular weight of 26.2kDa.;The Active form Activin-A is purified by standard chromatographic techniques.

Activin-B Human Recombinant Protein, Active

PROTP09529 Regular: 10ug
EUR 317
Description: Activin B human Recombinant produced in Nicotiana benthamiana plant is a beta-B single chain (aa 293-406) containing 123 amino acids (molecular formula C615H910N178O177S12). Activin B is fused to a 10-His-tag at the N-terminal having the total molecular mass of 14kDa and purified by standard chromatographic techniques.

Recombinant MeV Active Nucleocapsid Protein

VAng-Lsx0400-inquire inquire Ask for price
Description: Measles Active Nucleocapsid, recombinant protein from E. coli.

Active Cathepsin D, Human Recombinant

EUR 245

Active Cathepsin D, Human Recombinant

EUR 1132

Active Cathepsin D, Human Recombinant

EUR 735

MMP-14, Active, Human Recombinant

EUR 316

MMP-14, Active, Human Recombinant

EUR 805

Active Cathepsin S, human recombinant

EUR 338

Active Cathepsin S, human recombinant

EUR 1126

Active Cathepsin S, human recombinant

EUR 9130

Active Cathepsin B, human recombinant

EUR 9783

Active Cathepsin B, human recombinant

EUR 294

Active Cathepsin B, human recombinant

EUR 1132

Cathepsin K, Active, human recombinant

EUR 392

Cathepsin K, Active, human recombinant

EUR 2279

MMP-9, Active, human recombinant

EUR 501

MMP-9, Active, human recombinant

EUR 332

Recombinant Human Activin-A Active

7-00004 1ug Ask for price

Recombinant Human Activin-A Active

7-00005 5ug Ask for price

Recombinant Human Activin-A Active

7-00006 100µg Ask for price

Recombinant Human Activin-B Active

7-00010 1ug Ask for price

Recombinant Human Activin-B Active

7-00011 5ug Ask for price

Recombinant Human Activin-B Active

7-00012 100µg Ask for price

5-Lipoxygenase, Active, Human Recombinant

EUR 316

MMP-9, Active, Human Recombinant

P1567-10 10 µg
EUR 348

MMP-9, Active, Human Recombinant

P1567-50 50 µg
EUR 510

Purified Recombinant Human BMP3 protein, Biologically active

BMP35-R-10 10 ug
EUR 408

Purified Recombinant Human BMP4 protein, Biologically active,

BMP45-R-10 10 ug
EUR 895

Purified Recombinant Human BMP4 protein, Biologically active

BMP45-R-5 5 ug
EUR 529

Purified Recombinant Human BMP6 protein, Biologically active

BMP65-R-20 20 ug
EUR 895

Recombinant purified, human NFkB-p65 protein, active

NFKB651-R-5 5 ug
EUR 651

Activin-A Human Recombinant Protein, Plant-Active

PROTP08476-3 Regular: 5ug
EUR 317
Description: Active form Activin-A Human Recombinant produced in Plant is a homodimeric, glycosylated, polypeptide chain containing 2 x 116 amino acids and having a molecular weight of 27.4kDa.;The Active form Activin-A is fused to a 6-His tag at N-terminus and purified by standard chromatographic techniques.

Purified, recombinant Human TACE control protein (active)

TACE15-R-10 10 ug
EUR 712

Human Recombinant VEGF121 Protein (Sf9), biologically active

VEGF24-R-10 10 ug
EUR 445

Human Recombinant VEGF121 Protein (Sf9), biologically active

VEGF24-R-100 100 ug
EUR 2425

Human Recombinant VEGF121 Protein (E.Coli), biologically active

VEGF25-R-10 10 ug
EUR 445

Human Recombinant VEGF121 Protein (E.Coli), biologically active

VEGF25-R-100 100 ug
EUR 2425

Human Recombinant VEGF165 Protein (E.Coli), biologically active

VEGF26-R-10 10 ug
EUR 445

Human Recombinant VEGF165 Protein (E.Coli), biologically active

VEGF26-R-100 100 ug
EUR 2242

Human Recombinant VEGF165 Protein (E.Coli), biologically active

VEGF26-R-1000 1000 ug
EUR 9185

Human Recombinant VEGF165 Protein (Sf9), biologically active

VEGF27-R-10 10 ug
EUR 445

Human Recombinant VEGF165 Protein (HEK), biologically active

VEGF27-R-100 100 ug
EUR 2425

Human Recombinant VEGF165 Protein (Sf9), biologically active

VEGF27-R-1000 1000 ug
EUR 9185

PGP Human, Phosphoglycolate Phosphatase Human Recombinant Protein, Active

PROTA6NDG6-1 Regular: 10ug
EUR 317
Description: PGP Human Recombinant produced in E.coli is a single, non-glycosylated polypeptide chain containing 345 amino acids (1-321a.a) and having a molecular mass of 36.5kDa.;PGP is fused to a 24 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.

CSTA Human, Cystatin-A Human Recombinant Protein, Active

PROTP01040 Regular: 20ug
EUR 317
Description: Cystatin A Human Recombinant produced in E.Coli is a single, non-glycosylated, Polypeptide chain containing 118 amino acids (1-98a.a.) and having a molecular mass of 13.1 kDa.;The Cystatin A is fused to a 20 amino acid His tag at N-terminus and purified by proprietary chromatographic techniques.

Human, Activin-A Human Recombinant Protein, HEK-Active

PROTP08476-1 Regular: 10ug
EUR 317
Description: Activin-A Human Recombinant produced in HEK cells is a non-glycosylated disulfide-linked homodimer, having a total molecular weight of 25kDa.;The Activin-A is purified by proprietary chromatographic techniques.

GDA Human, Guanine Deaminase Human Recombinant Protein, Active

PROTQ9Y2T3-2 Regular: 10ug
EUR 317
Description: GDA Human Recombinant produced in E. coli is a single polypeptide chain containing 477 amino acids (1-454) and having a molecular mass of 53kDa.;GDA is fused to a 23 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.

GLUL Human, Glutamine Synthetase Human Recombinant Protein, Active

PROTP15104-1 Regular: 10ug
EUR 317
Description: GLUL Recombinant Human produced in E.Coli is a single, non-glycosylated polypeptide chain containing 373 amino acids (1-373) and having a molecular mass of 42kDa.

GLO1 Human, Glyoxalase-I Human Recombinant Protein, Active

PROTQ04760-1 Regular: 10ug
EUR 317
Description: Glyoxalase-I Human Recombinant produced in E.Coli is a single, non-glycosylated, polypeptide chain containing 184 amino acids and having a molecular mass of 20.7 kDa. ;Glyoxalase-1 is purified by proprietary chromatographic techniques.

CST3 Human, Cystatin-C Human Recombinant Protein, Active

PROTQ6FGW9-1 Regular: 10ug
EUR 317
Description: Cystatin-C Human Recombinant produced in HEK cells is a non-glycosylated monomer, having a molecular weight of approximately 13kDa.;The Cystatin-C is purified by proprietary chromatographic techniques.

MGLL Human, Monoglyceride Lipase Human Recombinant Protein, Active

PROTQ99685-1 Regular: 5ug
EUR 317
Description: MGLL Human Recombinant fused with a 20 amino acid His tag at N-terminus produced in E.Coli is a single, non-glycosylated, polypeptide chain containing 333 amino acids (1-313 a.a.) and having a molecular mass of 36.4kDa. The MGLL is purified by proprietary chromatographic techniques.

Human CellExp? HDAC6, Human Recombinant, Active

EUR 446

Human CellExp? HDAC8, Human Recombinant, Active

EUR 446

Human CellExp? HDAC11, Human Recombinant, Active

EUR 446

Human SOD Protein (Active)

  • EUR 314.00
  • EUR 732.00
  • EUR 1295.00
  • 100 ug
  • 1 mg
  • 2 mg
  • Shipped within 5-10 working days.

Active Human HSP70 Protein

SPR-108A 0.05 mg
EUR 300
  • HSP70 genes encode abundant heat-inducible 70-kDa HSPs (HSP70s). In most eukaryotes HSP70 genes exist as part of a multigene family. They are found in most cellular compartments of eukaryotes including nuclei, mitochondria, chloroplasts, the endoplas
  • Show more
Description: Untagged recombinant human HSP70 Protein expressed in E. coli for WB, SDS-PAGE, ATPase Activity Assay, Functional Assay, ELISA. This protein is biologically active (ATPase active).

Active Human HSP70 Protein

SPR-108B 0.1 mg
EUR 388
  • HSP70 genes encode abundant heat-inducible 70-kDa HSPs (HSP70s). In most eukaryotes HSP70 genes exist as part of a multigene family. They are found in most cellular compartments of eukaryotes including nuclei, mitochondria, chloroplasts, the endoplas
  • Show more
Description: Untagged recombinant human HSP70 Protein expressed in E. coli for WB, SDS-PAGE, ATPase Activity Assay, Functional Assay, ELISA. This protein is biologically active (ATPase active).

Active Human HSP70 Protein

SPR-108C 2x0.1 mg
EUR 669
  • HSP70 genes encode abundant heat-inducible 70-kDa HSPs (HSP70s). In most eukaryotes HSP70 genes exist as part of a multigene family. They are found in most cellular compartments of eukaryotes including nuclei, mitochondria, chloroplasts, the endoplas
  • Show more
Description: Untagged recombinant human HSP70 Protein expressed in E. coli for WB, SDS-PAGE, ATPase Activity Assay, Functional Assay, ELISA. This protein is biologically active (ATPase active).

Active Human HSP70 Protein

SPR-115A 0.05 mg
EUR 346
  • HSP70 genes encode abundant heat-inducible 70-kDa HSPs (HSP70s). In most eukaryotes HSP70 genes exist as part of a multigene family. They are found in most cellular compartments of eukaryotes including nuclei, mitochondria, chloroplasts, the endoplas
  • Show more
Description: His tagged recombinant human HSP70 Protein expressed in Baculovirus/Hi5 cells for WB, SDS-PAGE, ATPase Activity Assay, Functional Assay, ELISA. This protein is biologically active (ATPase active).

Active Human HSP70 Protein

SPR-115B 0.1 mg
EUR 477
  • HSP70 genes encode abundant heat-inducible 70-kDa HSPs (HSP70s). In most eukaryotes HSP70 genes exist as part of a multigene family. They are found in most cellular compartments of eukaryotes including nuclei, mitochondria, chloroplasts, the endoplas
  • Show more
Description: His tagged recombinant human HSP70 Protein expressed in Baculovirus/Hi5 cells for WB, SDS-PAGE, ATPase Activity Assay, Functional Assay, ELISA. This protein is biologically active (ATPase active).

Active Human HSP70 Protein

SPR-115C 2x0.1 mg
EUR 813
  • HSP70 genes encode abundant heat-inducible 70-kDa HSPs (HSP70s). In most eukaryotes HSP70 genes exist as part of a multigene family. They are found in most cellular compartments of eukaryotes including nuclei, mitochondria, chloroplasts, the endoplas
  • Show more
Description: His tagged recombinant human HSP70 Protein expressed in Baculovirus/Hi5 cells for WB, SDS-PAGE, ATPase Activity Assay, Functional Assay, ELISA. This protein is biologically active (ATPase active).

Active Human HSP70 Protein

SPR-103A 0.05 mg
EUR 300
  • HSP70 genes encode abundant heat-inducible 70-kDa HSPs (HSP70s). In most eukaryotes HSP70 genes exist as part of a multigene family. They are found in most cellular compartments of eukaryotes including nuclei, mitochondria, chloroplasts, the endoplas
  • Show more
Description: His tagged recombinant human HSP70 Protein expressed in E. coli for WB, SDS-PAGE, ATPase Activity Assay, Functional Assay, ELISA. This protein is biologically active (ATPase active).

Active Human HSP70 Protein

SPR-103B 0.1 mg
EUR 388
  • HSP70 genes encode abundant heat-inducible 70-kDa HSPs (HSP70s). In most eukaryotes HSP70 genes exist as part of a multigene family. They are found in most cellular compartments of eukaryotes including nuclei, mitochondria, chloroplasts, the endoplas
  • Show more
Description: His tagged recombinant human HSP70 Protein expressed in E. coli for WB, SDS-PAGE, ATPase Activity Assay, Functional Assay, ELISA. This protein is biologically active (ATPase active).

Evaluating completely different sperm separation strategies for ART, via quantitative analysis of p53 protein

Context: Within the final 10 years, assisted reproductive applied sciences (ARTs) have supplied infertile {couples} a possibility to finish their reproductive undertaking. Nevertheless, the excessive failure price could possibly be defined with the complicated human replica system. In ART, the lower of the success is as a result of situations removed from the pure ones.
Goals: The intention of this research is to guage deoxyribonucleic acid (DNA) injury of spermatozoa earlier than and after choice procedures, utilizing a brand new approach capable of quantize sperm DNA injury.
Settings and design: They had been concerned 43 males domiciled completely in two areas with completely different Environmental Impression, HEI (excessive environmental impression) and LEI (Low environmental impression), they’re aged between 24 and 31 years with varied levels of dyspermia.
Topics and strategies: The 43 males had been divided into two teams: 21 in Group A (EIL) and 22 in Group B (EIH). The samples should be aliquoted into components of 0.5 mL: Group (a) Management, no processing; Group (b) Swim-up (SUP) from semen; Group (c) basic SUP; Group (d) density gradient centrifugation (DGC). All samples had been subjected to a quantitative dosage of p53 protein, earlier than and after processing.
Statistical evaluation used: For the event of the chance and significance of the information, the Scholar’s t-test was used.
Outcomes: From our information, it emerges that Teams D and B present a superior high quality about motility, vitality, and apoptosis indexes in comparison with different typical strategies. In Group B, apoptosis is akin to Group D, however they’ve barely decrease about motility and vitality.
Group C is the one which has decrease parameters than the opposite strategies. Concerning the analysis of p53 protein, the outcomes are conflicting with the analysis of apoptosis; in truth, in Group D, the values are considerably larger than the opposite strategies.
Conclusions: Sperm separation is a vital second in ART strategies. From our information, it emerges a better fragility of DNA within the male spermatozoa who reside completely in areas with excessive environmental impression.

SRPX2 Antibody

DF12480 200ul
EUR 304
Description: SRPX2 antibody detects endogenous levels of SRPX2.

SRPX2 Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against SRPX2. Recognizes SRPX2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

Mouse Sushi repeat-containing protein SRPX2 (Srpx2)

  • EUR 505.00
  • EUR 265.00
  • EUR 1827.00
  • EUR 766.00
  • EUR 1218.00
  • EUR 335.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 70.5 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Mouse Sushi repeat-containing protein SRPX2(Srpx2) expressed in E.coli

Mouse Sushi repeat-containing protein SRPX2 (Srpx2)

  • EUR 840.00
  • EUR 332.00
  • EUR 2170.00
  • EUR 1135.00
  • EUR 1579.00
  • EUR 470.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 54.5 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Mouse Sushi repeat-containing protein SRPX2(Srpx2) expressed in Baculovirus

HEK-293T Telomerase Over-Expressing Cell Pellet

abx069991-1Pellet 1 Pellet
EUR 398
  • Shipped within 1-3 working days.

Polyclonal SRPX2 Antibody

APR13540G 0.1 mg
EUR 659
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human SRPX2 . This antibody is tested and proven to work in the following applications:

SRPX2 cloning plasmid

CSB-CL022690HU-10ug 10ug
EUR 502
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1398
  • Sequence: atggccagtcagctaactcaaagaggagctctctttctgctgttcttcctaactccggcagtgacaccaacatggtatgcaggttctggctactatccggatgaaagctacaatgaagtatatgcagaggaggtcccacaggctcctgccctggactaccgagtcccccgatggt
  • Show more
Description: A cloning plasmid for the SRPX2 gene.

anti- SRPX2 antibody

FNab08240 100µg
EUR 548.75
  • Immunogen: sushi-repeat-containing protein, X-linked 2
  • Uniprot ID: O60687
  • Gene ID: 27286
  • Research Area: Neuroscience
Description: Antibody raised against SRPX2

SRPX2 Rabbit pAb

A15434-100ul 100 ul
EUR 308

SRPX2 Rabbit pAb

A15434-200ul 200 ul
EUR 459

SRPX2 Rabbit pAb

A15434-20ul 20 ul
EUR 183

SRPX2 Rabbit pAb

A15434-50ul 50 ul
EUR 223

SRPX2 Polyclonal Antibody

28966-100ul 100ul
EUR 252

SRPX2 Polyclonal Antibody

28966-50ul 50ul
EUR 187

SRPX2 Blocking Peptide

DF12480-BP 1mg
EUR 195

Anti-SRPX2 antibody

PAab08240 100 ug
EUR 386

Anti-SRPX2 Antibody

STJ503134 100 µg
EUR 476

Anti-SRPX2 antibody

STJ117629 100 µl
EUR 277
Description: This gene encodes a secreted protein that contains three sushi repeat motifs. The encoded protein may play a role in the development of speech and language centers in the brain. This protein may also be involved in angiogenesis. Mutations in this gene are the cause of bilateral perisylvian polymicrogyria, rolandic epilepsy, speech dyspraxia and mental retardation.

Bovine Sushi repeat- containing protein SRPX2, SRPX2 ELISA KIT

ELI-18130b 96 Tests
EUR 928

Mouse Sushi repeat- containing protein SRPX2, Srpx2 ELISA KIT

ELI-53443m 96 Tests
EUR 865

Human Sushi repeat- containing protein SRPX2, SRPX2 ELISA KIT

ELI-29242h 96 Tests
EUR 824

Bluing Reagent

BRT030 30 ml
EUR 60

Bluing Reagent

BRT125 125 ml
EUR 63

Bluing Reagent

BRT3800 1 Gal.
EUR 184

Bluing Reagent

BRT500 500 ml
EUR 76

Bluing Reagent

BRT999 1000 ml
EUR 88

Beaucage reagent

HY-100951 10mM/1mL
EUR 126

BOP reagent

A7015-100000 100 g
EUR 200
Description: A peptide coupling reagent. Can be used in the preparation of phenyl esters of amino acids which have been shown to be valuable as blocked derivatives of amino acids in the field of peptide synthesis.

BOP reagent

A7015-25000 25 g
EUR 113
Description: A peptide coupling reagent. Can be used in the preparation of phenyl esters of amino acids which have been shown to be valuable as blocked derivatives of amino acids in the field of peptide synthesis.

BOP reagent

5-02141 25g Ask for price

BOP reagent

5-02142 100g Ask for price

Chymase reagent

30C-CP1129 5 units
EUR 2185
Description: Purified native Human Chymase reagent

Traut's Reagent

EUR 349

Traut's Reagent

EUR 207

MTS Reagent

EUR 990

MTS Reagent

EUR 365

MTT Reagent

EUR 180

MTT Reagent

EUR 544

Bradford reagent

BDE641 100ml
EUR 61.01
  • Product category: Biochemicals/Biology Reagents/Protein Related

Polyclonal SRPX2 Antibody (Internal)

APR13542G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human SRPX2 (Internal). This antibody is tested and proven to work in the following applications:

SRPX2 Polyclonal Conjugated Antibody

C28966 100ul
EUR 397

Mouse SRPX2 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Rat SRPX2 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.


EHS0181 96Tests
EUR 521


EGTS0181 96Tests
EUR 521

Bovine SRPX2 ELISA Kit

EBS0181 96Tests
EUR 521

Chicken SRPX2 ELISA Kit

ECKS0181 96Tests
EUR 521

Canine SRPX2 ELISA Kit

ECS0181 96Tests
EUR 521


EF003243 96 Tests
EUR 689

Porcine SRPX2 ELISA Kit

EPS0181 96Tests
EUR 521


ERS0181 96Tests
EUR 521


ESS0181 96Tests
EUR 521

Rabbit SRPX2 ELISA Kit

ERTS0181 96Tests
EUR 521

Monkey SRPX2 ELISA Kit

EMKS0181 96Tests
EUR 521


EMS0181 96Tests
EUR 521

Human SRPX2 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

SRPX2 Recombinant Protein (Human)

RP030124 100 ug Ask for price

SRPX2 Recombinant Protein (Rat)

RP231089 100 ug Ask for price

SRPX2 Recombinant Protein (Mouse)

RP175466 100 ug Ask for price

SRPX2 Recombinant Protein (Mouse)

RP175469 100 ug Ask for price

Anti-SRPX2 Antibody (Biotin)

STJ503135 100 µg
EUR 586

Anti-SRPX2 Antibody (FITC)

STJ503136 100 µg
EUR 586

JM109-lysate Antibody

abx234439-100ug 100 ug
EUR 551
  • Shipped within 5-12 working days.

BL21-lysate Antibody

abx230905-100ug 100 ug
EUR 551
  • Shipped within 5-12 working days.

DH5a-lysate Antibody

abx232362-100ug 100 ug
EUR 551
  • Shipped within 5-12 working days.

CMV Cell Lysate

35-1867 1 mg
EUR 1835
Description: CMV enriched cell lysate

HSV1 Cell Lysate

35-1872 1 ml
EUR 394
Description: HSV1 enriched cell lysate

HSV2 Cell Lysate

35-1873 1 ml
EUR 394
Description: HSV2 enriched cell lysate

Arabidopsis Thaliana Lysate

30R-AA023 150 ug
EUR 156
Description: Arabidopsis Thaliana Plant Lysate

Green Algae Lysate

PABL-1306 50 ug
EUR 164

PhosphoBlocker Blocking Reagent

AKR-103 1L
EUR 328
Description: Most commercially available Western blot blockers, such as dry milk or serum, are sufficient to block unreactive sites on the membrane. However, they are not designed to preserve phosphoprotein antigens during blotting. Our PhosphoBLOCKER Blocking Reagent provides superior blocking by maximizing signal-to-noise ratio. The PhosphoBLOCKER reagent particluarly excels with very low levels of endogenous phopsphoproteins.

PhosphoBlocker Blocking Reagent

AKR-104 4L
EUR 711
Description: Most commercially available Western blot blockers, such as dry milk or serum, are sufficient to block unreactive sites on the membrane. However, they are not designed to preserve phosphoprotein antigens during blotting. Our PhosphoBLOCKER Blocking Reagent provides superior blocking by maximizing signal-to-noise ratio. The PhosphoBLOCKER reagent particluarly excels with very low levels of endogenous phopsphoproteins.

Leave a Reply

Your email address will not be published. Required fields are marked *