Fragment Screening for 14 Different Biologically Active RNAs and 10 DNA and protein counter-screens

choleratox

19F-NMR-based fragment screening for 14 completely different biologically lively RNAs and 10 DNA and protein counter-screens

 

We report right here on the nuclear magnetic resonance (NMR) 19 F screening of 14 RNA targets with completely different secondary and tertiary construction to systematically assess druggability of RNAs. Our RNA targets embody consultant bacterial riboswitches that naturally bind with nanomolar affinity and excessive specificity to mobile metabolites of low molecular weight.
Primarily based on counter-screens in opposition to 5 DNAs and 5 proteins, we are able to present that RNA will be particularly focused. To reveal the standard of the preliminary fragment library that has been designed for simple follow-up chemistry, we additional present the best way to enhance binding affinity from an preliminary fragment hit by chemistry that hyperlinks the recognized fragment to the intercalator acridine. Thus, we obtain low micromolar binding affinity with out dropping binding specificity between two completely different terminator buildings.

Predicting persistence of atopic dermatitis in youngsters utilizing scientific attributes and serum proteins

 

Background: Atopic dermatitis (AD) is the commonest inflammatory pores and skin illness in youngsters, with 30% of all these identified creating power or relapsing illness by adolescence. Such illness persistence can’t but be predicted. The intention of the current research was to foretell the pure course of AD utilizing scientific parameters and serum proteins.
Strategies: Sera of 144 youngsters with AD (age 0-Three years) had been analyzed for IgE and 33 cytokines, chemokines, and development components. Affected person illness course till the age of seven years was assessed retrospectively. Unsupervised k-means clustering was carried out to outline illness endotypes.
Recognized components related to AD persistence on the age of seven years had been validated in youngsters with AD in an unbiased cohort (LISA Munich; n=168). Logistic regression and XGBoosting strategies adopted by cross-validation had been utilized to foretell particular person illness outcomes.
Outcomes: Three distinct endotypes had been present in infancy, characterised by a novel inflammatory signature. Elements related to illness persistence had been illness rating (SCORAD), involvement of the limbs, flexural lesion distribution on the age of three years, allergic comorbidities and illness exacerbation by the set off components stress, pollen publicity, and alter in climate.
Persistence was predicted with a sensitivity of 81.8% and a specificity of 82.4%. Elements with a excessive impression on the prediction of persistence had been SCORAD on the age of three years, set off components, and low VEGF serum ranges.
Conclusions: AD in infancy contains three immunological endotypes. Illness persistence will be predicted utilizing serum cytokines and scientific variables.
choleratox

choleratox

Active AHCY, human recombinant

7527-50
EUR 479.00

Active Recombinant Human CETP

7606-100
EUR 805.00

Active Recombinant Human CETP

7606-1000
EUR 4345.00

Active Recombinant Human CETP

7606-20
EUR 262.00

Active SIRT2, human recombinant

7698-10
EUR 262.00

Active SIRT2, human recombinant

7698-1000
EUR 4394.00

Active SIRT2, human recombinant

7698-50
EUR 457.00

Active SIRT7, human recombinant

7846-10
EUR 218.00

Active SIRT7, human recombinant

7846-50
EUR 588.00

Irisin, Active, human recombinant

7852-10
EUR 370.00

Irisin, Active, human recombinant

7852-50
EUR 1077.00

HER2, Active, Human Recombinant

8011-5
EUR 240.00

HER2, Active, Human Recombinant

8011-50
EUR 1132.00

PRMT1, human recombinant (Active)

4865-10
EUR 153.00

PRMT1, human recombinant (Active)

4865-1000
EUR 3834.00

PRMT1, human recombinant (Active)

4865-50
EUR 392.00

GAPDH, Active, human recombinant

P1100-10
EUR 142.00

GAPDH, Active, human recombinant

P1100-50
EUR 392.00

Activin-A Human Recombinant Protein, Active

PROTP08476-2 Regular: 10ug
EUR 317.00
Description: Active form Activin-A Human Recombinant produced in e.coli is a homodimeric, non-glycosylated, polypeptide chain containing 2 x 117 amino acids and having a molecular weight of 26.2kDa.;The Active form Activin-A is purified by standard chromatographic techniques.

Activin-B Human Recombinant Protein, Active

PROTP09529 Regular: 10ug
EUR 317.00
Description: Activin B human Recombinant produced in Nicotiana benthamiana plant is a beta-B single chain (aa 293-406) containing 123 amino acids (molecular formula C615H910N178O177S12). Activin B is fused to a 10-His-tag at the N-terminal having the total molecular mass of 14kDa and purified by standard chromatographic techniques.

Recombinant MeV Active Nucleocapsid Protein

VAng-Lsx0400-inquire inquire Ask for price
Description: Measles Active Nucleocapsid, recombinant protein from E. coli.

Active Cathepsin S, human recombinant

7526-10
EUR 338.00

Active Cathepsin S, human recombinant

7526-50
EUR 1126.00

Active Cathepsin S, human recombinant

7526-500
EUR 9130.00

Active Cathepsin B, human recombinant

7580-1000
EUR 9783.00

Active Cathepsin B, human recombinant

7580-5
EUR 294.00

Active Cathepsin B, human recombinant

7580-50
EUR 1132.00

Cathepsin K, Active, human recombinant

7600-5
EUR 392.00

Cathepsin K, Active, human recombinant

7600-50
EUR 2279.00

MMP-9, Active, human recombinant

7867-1000
EUR 501.00

MMP-9, Active, human recombinant

7867-500
EUR 332.00

MMP-14, Active, Human Recombinant

8009-10
EUR 316.00

MMP-14, Active, Human Recombinant

8009-50
EUR 805.00

Active Cathepsin D, Human Recombinant

9229-10
EUR 245.00

Active Cathepsin D, Human Recombinant

9229-100
EUR 1132.00

Active Cathepsin D, Human Recombinant

9229-50
EUR 735.00

Recombinant Human Activin-A Active

7-00004 1ug Ask for price

Recombinant Human Activin-A Active

7-00005 5ug Ask for price

Recombinant Human Activin-A Active

7-00006 100µg Ask for price

Recombinant Human Activin-B Active

7-00010 1ug Ask for price

Recombinant Human Activin-B Active

7-00011 5ug Ask for price

Recombinant Human Activin-B Active

7-00012 100µg Ask for price

5-Lipoxygenase, Active, Human Recombinant

P1373-200
EUR 316.00

Purified Recombinant Human BMP3 protein, Biologically active

BMP35-R-10 10 ug
EUR 408.00

Purified Recombinant Human BMP4 protein, Biologically active,

BMP45-R-10 10 ug
EUR 895.00

Purified Recombinant Human BMP4 protein, Biologically active

BMP45-R-5 5 ug
EUR 529.00

Purified Recombinant Human BMP6 protein, Biologically active

BMP65-R-20 20 ug
EUR 895.00

Activin-A Human Recombinant Protein, Plant-Active

PROTP08476-3 Regular: 5ug
EUR 317.00
Description: Active form Activin-A Human Recombinant produced in Plant is a homodimeric, glycosylated, polypeptide chain containing 2 x 116 amino acids and having a molecular weight of 27.4kDa.;The Active form Activin-A is fused to a 6-His tag at N-terminus and purified by standard chromatographic techniques.

Recombinant purified, human NFkB-p65 protein, active

NFKB651-R-5 5 ug
EUR 651.00

Purified, recombinant Human TACE control protein (active)

TACE15-R-10 10 ug
EUR 712.00

Human Recombinant VEGF121 Protein (Sf9), biologically active

VEGF24-R-10 10 ug
EUR 445.00

Human Recombinant VEGF121 Protein (Sf9), biologically active

VEGF24-R-100 100 ug
EUR 2425.00

Human Recombinant VEGF121 Protein (E.Coli), biologically active

VEGF25-R-10 10 ug
EUR 445.00

Human Recombinant VEGF121 Protein (E.Coli), biologically active

VEGF25-R-100 100 ug
EUR 2425.00

Human Recombinant VEGF165 Protein (E.Coli), biologically active

VEGF26-R-10 10 ug
EUR 445.00

Human Recombinant VEGF165 Protein (E.Coli), biologically active

VEGF26-R-100 100 ug
EUR 2242.00

Human Recombinant VEGF165 Protein (E.Coli), biologically active

VEGF26-R-1000 1000 ug
EUR 9185.00

Human Recombinant VEGF165 Protein (Sf9), biologically active

VEGF27-R-10 10 ug
EUR 445.00

Human Recombinant VEGF165 Protein (HEK), biologically active

VEGF27-R-100 100 ug
EUR 2425.00

Human Recombinant VEGF165 Protein (Sf9), biologically active

VEGF27-R-1000 1000 ug
EUR 9185.00

Human SOD Protein (Active)

20-abx060221
  • EUR 314.00
  • EUR 732.00
  • EUR 1295.00
  • 100 ug
  • 1 mg
  • 2 mg
  • Shipped within 5-10 working days.

Active Human HSP70 Protein

SPR-103A 0.05 mg
EUR 300.00
  • HSP70 genes encode abundant heat-inducible 70-kDa HSPs (HSP70s). In most eukaryotes HSP70 genes exist as part of a multigene family. They are found in most cellular compartments of eukaryotes including nuclei, mitochondria, chloroplasts, the endoplas
  • Show more
Description: His tagged recombinant human HSP70 Protein expressed in E. coli for WB, SDS-PAGE, ATPase Activity Assay, Functional Assay, ELISA. This protein is biologically active (ATPase active).

Active Human HSP70 Protein

SPR-103B 0.1 mg
EUR 388.00
  • HSP70 genes encode abundant heat-inducible 70-kDa HSPs (HSP70s). In most eukaryotes HSP70 genes exist as part of a multigene family. They are found in most cellular compartments of eukaryotes including nuclei, mitochondria, chloroplasts, the endoplas
  • Show more
Description: His tagged recombinant human HSP70 Protein expressed in E. coli for WB, SDS-PAGE, ATPase Activity Assay, Functional Assay, ELISA. This protein is biologically active (ATPase active).

Active Human HSP70 Protein

SPR-103C 2x0.1 mg
EUR 669.00
  • HSP70 genes encode abundant heat-inducible 70-kDa HSPs (HSP70s). In most eukaryotes HSP70 genes exist as part of a multigene family. They are found in most cellular compartments of eukaryotes including nuclei, mitochondria, chloroplasts, the endoplas
  • Show more
Description: His tagged recombinant human HSP70 Protein expressed in E. coli for WB, SDS-PAGE, ATPase Activity Assay, Functional Assay, ELISA. This protein is biologically active (ATPase active).

Active Human HSP60 Protein

SPR-104A 0.05 mg
EUR 231.00
  • In both prokaryotic and eukaryotic cells, the misfolding and aggregation of proteins during biogenesis and under conditions of cellular stress are prevented by molecular chaperones. Members of the HSP60 family of heat shock proteins are some of the b
  • Show more
Description: His tagged recombinant human HSP60 Protein expressed in E. coli for WB, SDS-PAGE, ATPase Activity Assay, Functional Assay, ELISA. This protein is biologically active (ATPase active).

Active Human HSP60 Protein

SPR-104B 0.1 mg
EUR 387.00
  • In both prokaryotic and eukaryotic cells, the misfolding and aggregation of proteins during biogenesis and under conditions of cellular stress are prevented by molecular chaperones. Members of the HSP60 family of heat shock proteins are some of the b
  • Show more
Description: His tagged recombinant human HSP60 Protein expressed in E. coli for WB, SDS-PAGE, ATPase Activity Assay, Functional Assay, ELISA. This protein is biologically active (ATPase active).

Active Human HSP60 Protein

SPR-104C 2x0.1 mg
EUR 568.00
  • In both prokaryotic and eukaryotic cells, the misfolding and aggregation of proteins during biogenesis and under conditions of cellular stress are prevented by molecular chaperones. Members of the HSP60 family of heat shock proteins are some of the b
  • Show more
Description: His tagged recombinant human HSP60 Protein expressed in E. coli for WB, SDS-PAGE, ATPase Activity Assay, Functional Assay, ELISA. This protein is biologically active (ATPase active).

Active Human HSC70 Protein

SPR-106A 0.05 mg
EUR 236.00
  • HSP70 genes encode abundant heat-inducible 70-kDa HSPs (HSP70s). In most eukaryotes HSP70 genes exist as part of a multigene family. They are found in most cellular compartments of eukaryotes including nuclei, mitochondria, chloroplasts, the endoplas
  • Show more
Description: His tagged recombinant human HSC70 Protein expressed in E. coli for WB, SDS-PAGE, ATPase Activity Assay, Functional Assay, ELISA. This protein is biologically active (ATPase active).

Active Human HSC70 Protein

SPR-106B 0.1 mg
EUR 310.00
  • HSP70 genes encode abundant heat-inducible 70-kDa HSPs (HSP70s). In most eukaryotes HSP70 genes exist as part of a multigene family. They are found in most cellular compartments of eukaryotes including nuclei, mitochondria, chloroplasts, the endoplas
  • Show more
Description: His tagged recombinant human HSC70 Protein expressed in E. coli for WB, SDS-PAGE, ATPase Activity Assay, Functional Assay, ELISA. This protein is biologically active (ATPase active).

Active Human HSC70 Protein

SPR-106C 2x0.1 mg
EUR 538.00
  • HSP70 genes encode abundant heat-inducible 70-kDa HSPs (HSP70s). In most eukaryotes HSP70 genes exist as part of a multigene family. They are found in most cellular compartments of eukaryotes including nuclei, mitochondria, chloroplasts, the endoplas
  • Show more
Description: His tagged recombinant human HSC70 Protein expressed in E. coli for WB, SDS-PAGE, ATPase Activity Assay, Functional Assay, ELISA. This protein is biologically active (ATPase active).

Active Human HSP70 Protein

SPR-108A 0.05 mg
EUR 300.00
  • HSP70 genes encode abundant heat-inducible 70-kDa HSPs (HSP70s). In most eukaryotes HSP70 genes exist as part of a multigene family. They are found in most cellular compartments of eukaryotes including nuclei, mitochondria, chloroplasts, the endoplas
  • Show more
Description: Untagged recombinant human HSP70 Protein expressed in E. coli for WB, SDS-PAGE, ATPase Activity Assay, Functional Assay, ELISA. This protein is biologically active (ATPase active).

Active Human HSP70 Protein

SPR-108B 0.1 mg
EUR 388.00
  • HSP70 genes encode abundant heat-inducible 70-kDa HSPs (HSP70s). In most eukaryotes HSP70 genes exist as part of a multigene family. They are found in most cellular compartments of eukaryotes including nuclei, mitochondria, chloroplasts, the endoplas
  • Show more
Description: Untagged recombinant human HSP70 Protein expressed in E. coli for WB, SDS-PAGE, ATPase Activity Assay, Functional Assay, ELISA. This protein is biologically active (ATPase active).

Active Human HSP70 Protein

SPR-108C 2x0.1 mg
EUR 669.00
  • HSP70 genes encode abundant heat-inducible 70-kDa HSPs (HSP70s). In most eukaryotes HSP70 genes exist as part of a multigene family. They are found in most cellular compartments of eukaryotes including nuclei, mitochondria, chloroplasts, the endoplas
  • Show more
Description: Untagged recombinant human HSP70 Protein expressed in E. coli for WB, SDS-PAGE, ATPase Activity Assay, Functional Assay, ELISA. This protein is biologically active (ATPase active).

Active Human HSP70 Protein

SPR-115A 0.05 mg
EUR 346.00
  • HSP70 genes encode abundant heat-inducible 70-kDa HSPs (HSP70s). In most eukaryotes HSP70 genes exist as part of a multigene family. They are found in most cellular compartments of eukaryotes including nuclei, mitochondria, chloroplasts, the endoplas
  • Show more
Description: His tagged recombinant human HSP70 Protein expressed in Baculovirus/Hi5 cells for WB, SDS-PAGE, ATPase Activity Assay, Functional Assay, ELISA. This protein is biologically active (ATPase active).

Active Human HSP70 Protein

SPR-115B 0.1 mg
EUR 477.00
  • HSP70 genes encode abundant heat-inducible 70-kDa HSPs (HSP70s). In most eukaryotes HSP70 genes exist as part of a multigene family. They are found in most cellular compartments of eukaryotes including nuclei, mitochondria, chloroplasts, the endoplas
  • Show more
Description: His tagged recombinant human HSP70 Protein expressed in Baculovirus/Hi5 cells for WB, SDS-PAGE, ATPase Activity Assay, Functional Assay, ELISA. This protein is biologically active (ATPase active).

Active Human HSP70 Protein

SPR-115C 2x0.1 mg
EUR 813.00
  • HSP70 genes encode abundant heat-inducible 70-kDa HSPs (HSP70s). In most eukaryotes HSP70 genes exist as part of a multigene family. They are found in most cellular compartments of eukaryotes including nuclei, mitochondria, chloroplasts, the endoplas
  • Show more
Description: His tagged recombinant human HSP70 Protein expressed in Baculovirus/Hi5 cells for WB, SDS-PAGE, ATPase Activity Assay, Functional Assay, ELISA. This protein is biologically active (ATPase active).

PGP Human, Phosphoglycolate Phosphatase Human Recombinant Protein, Active

PROTA6NDG6-1 Regular: 10ug
EUR 317.00
Description: PGP Human Recombinant produced in E.coli is a single, non-glycosylated polypeptide chain containing 345 amino acids (1-321a.a) and having a molecular mass of 36.5kDa.;PGP is fused to a 24 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.

CSTA Human, Cystatin-A Human Recombinant Protein, Active

PROTP01040 Regular: 20ug
EUR 317.00
Description: Cystatin A Human Recombinant produced in E.Coli is a single, non-glycosylated, Polypeptide chain containing 118 amino acids (1-98a.a.) and having a molecular mass of 13.1 kDa.;The Cystatin A is fused to a 20 amino acid His tag at N-terminus and purified by proprietary chromatographic techniques.

GLO1 Human, Glyoxalase-I Human Recombinant Protein, Active

PROTQ04760-1 Regular: 10ug
EUR 317.00
Description: Glyoxalase-I Human Recombinant produced in E.Coli is a single, non-glycosylated, polypeptide chain containing 184 amino acids and having a molecular mass of 20.7 kDa. ;Glyoxalase-1 is purified by proprietary chromatographic techniques.

CST3 Human, Cystatin-C Human Recombinant Protein, Active

PROTQ6FGW9-1 Regular: 10ug
EUR 317.00
Description: Cystatin-C Human Recombinant produced in HEK cells is a non-glycosylated monomer, having a molecular weight of approximately 13kDa.;The Cystatin-C is purified by proprietary chromatographic techniques.

MGLL Human, Monoglyceride Lipase Human Recombinant Protein, Active

PROTQ99685-1 Regular: 5ug
EUR 317.00
Description: MGLL Human Recombinant fused with a 20 amino acid His tag at N-terminus produced in E.Coli is a single, non-glycosylated, polypeptide chain containing 333 amino acids (1-313 a.a.) and having a molecular mass of 36.4kDa. The MGLL is purified by proprietary chromatographic techniques.

GDA Human, Guanine Deaminase Human Recombinant Protein, Active

PROTQ9Y2T3-2 Regular: 10ug
EUR 317.00
Description: GDA Human Recombinant produced in E. coli is a single polypeptide chain containing 477 amino acids (1-454) and having a molecular mass of 53kDa.;GDA is fused to a 23 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.

Evaluating completely different sperm separation strategies for ART, via quantitative analysis of p53 protein

Context: Within the final 10 years, assisted reproductive applied sciences (ARTs) have supplied infertile {couples} a possibility to finish their reproductive undertaking. Nevertheless, the excessive failure price could possibly be defined with the complicated human replica system. In ART, the lower of the success is as a result of situations removed from the pure ones.
Goals: The intention of this research is to guage deoxyribonucleic acid (DNA) injury of spermatozoa earlier than and after choice procedures, utilizing a brand new approach capable of quantize sperm DNA injury.
Settings and design: They had been concerned 43 males domiciled completely in two areas with completely different Environmental Impression, HEI (excessive environmental impression) and LEI (Low environmental impression), they’re aged between 24 and 31 years with varied levels of dyspermia.
Topics and strategies: The 43 males had been divided into two teams: 21 in Group A (EIL) and 22 in Group B (EIH). The samples should be aliquoted into components of 0.5 mL: Group (a) Management, no processing; Group (b) Swim-up (SUP) from semen; Group (c) basic SUP; Group (d) density gradient centrifugation (DGC). All samples had been subjected to a quantitative dosage of p53 protein, earlier than and after processing.
Statistical evaluation used: For the event of the chance and significance of the information, the Scholar’s t-test was used.
Outcomes: From our information, it emerges that Teams D and B present a superior high quality about motility, vitality, and apoptosis indexes in comparison with different typical strategies. In Group B, apoptosis is akin to Group D, however they’ve barely decrease about motility and vitality.
Group C is the one which has decrease parameters than the opposite strategies. Concerning the analysis of p53 protein, the outcomes are conflicting with the analysis of apoptosis; in truth, in Group D, the values are considerably larger than the opposite strategies.
Conclusions: Sperm separation is a vital second in ART strategies. From our information, it emerges a better fragility of DNA within the male spermatozoa who reside completely in areas with excessive environmental impression.

SRPX2 Antibody

25000-100ul 100ul
EUR 390.00

SRPX2 Antibody

1-CSB-PA022690GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against SRPX2. Recognizes SRPX2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

Mouse Sushi repeat-containing protein SRPX2 (Srpx2)

1-CSB-EP819154MO
  • EUR 505.00
  • EUR 265.00
  • EUR 1827.00
  • EUR 766.00
  • EUR 1218.00
  • EUR 335.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 70.5 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Mouse Sushi repeat-containing protein SRPX2(Srpx2) expressed in E.coli

Mouse Sushi repeat-containing protein SRPX2 (Srpx2)

1-CSB-BP819154MO
  • EUR 840.00
  • EUR 332.00
  • EUR 2170.00
  • EUR 1135.00
  • EUR 1579.00
  • EUR 470.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 54.5 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Mouse Sushi repeat-containing protein SRPX2(Srpx2) expressed in Baculovirus

HEK-293T Telomerase Over-Expressing Cell Pellet

abx069991-1Pellet 1 Pellet
EUR 398.00
  • Shipped within 1-3 working days.

SRPX2 Rabbit pAb

A15434-100ul 100 ul
EUR 308.00

SRPX2 Rabbit pAb

A15434-200ul 200 ul
EUR 459.00

SRPX2 Rabbit pAb

A15434-20ul 20 ul
EUR 183.00

SRPX2 Rabbit pAb

A15434-50ul 50 ul
EUR 223.00

SRPX2 Blocking Peptide

DF12480-BP 1mg
EUR 195.00

SRPX2 Polyclonal Antibody

28966-100ul 100ul
EUR 252.00

SRPX2 Polyclonal Antibody

28966-50ul 50ul
EUR 187.00

SRPX2 cloning plasmid

CSB-CL022690HU-10ug 10ug
EUR 502.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1398
  • Sequence: atggccagtcagctaactcaaagaggagctctctttctgctgttcttcctaactccggcagtgacaccaacatggtatgcaggttctggctactatccggatgaaagctacaatgaagtatatgcagaggaggtcccacaggctcctgccctggactaccgagtcccccgatggt
  • Show more
Description: A cloning plasmid for the SRPX2 gene.

Polyclonal SRPX2 Antibody

APR13540G 0.1 mg
EUR 659.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human SRPX2 . This antibody is tested and proven to work in the following applications:

Anti-SRPX2 antibody

PAab08240 100 ug
EUR 386.00

anti- SRPX2 antibody

FNab08240 100µg
EUR 548.75
  • Immunogen: sushi-repeat-containing protein, X-linked 2
  • Uniprot ID: O60687
  • Gene ID: 27286
  • Research Area: Neuroscience
Description: Antibody raised against SRPX2

Anti-SRPX2 antibody

STJ117629 100 µl
EUR 277.00
Description: This gene encodes a secreted protein that contains three sushi repeat motifs. The encoded protein may play a role in the development of speech and language centers in the brain. This protein may also be involved in angiogenesis. Mutations in this gene are the cause of bilateral perisylvian polymicrogyria, rolandic epilepsy, speech dyspraxia and mental retardation.

Anti-SRPX2 Antibody

STJ503134 100 µg
EUR 476.00

Mouse Sushi repeat- containing protein SRPX2, Srpx2 ELISA KIT

ELI-53443m 96 Tests
EUR 865.00

Bovine Sushi repeat- containing protein SRPX2, SRPX2 ELISA KIT

ELI-18130b 96 Tests
EUR 928.00

Human Sushi repeat- containing protein SRPX2, SRPX2 ELISA KIT

ELI-29242h 96 Tests
EUR 824.00

BOP reagent

A7015-100000 100 g
EUR 200.00
Description: A peptide coupling reagent. Can be used in the preparation of phenyl esters of amino acids which have been shown to be valuable as blocked derivatives of amino acids in the field of peptide synthesis.

BOP reagent

A7015-25000 25 g
EUR 113.00
Description: A peptide coupling reagent. Can be used in the preparation of phenyl esters of amino acids which have been shown to be valuable as blocked derivatives of amino acids in the field of peptide synthesis.

BOP reagent

5-02141 25g Ask for price

BOP reagent

5-02142 100g Ask for price

Chymase reagent

30C-CP1129 5 units
EUR 2185.00
Description: Purified native Human Chymase reagent

Traut's Reagent

2330-1000
EUR 349.00

Traut's Reagent

2330-500
EUR 207.00

MTS Reagent

2808-1000
EUR 990.00

MTS Reagent

2808-250
EUR 365.00

MTT Reagent

2809-1G
EUR 180.00

MTT Reagent

2809-5G
EUR 544.00

Bluing Reagent

BRT030 30 ml
EUR 60.00

Bluing Reagent

BRT125 125 ml
EUR 63.00

Bluing Reagent

BRT3800 1 Gal.
EUR 184.00

Bluing Reagent

BRT500 500 ml
EUR 76.00

Bluing Reagent

BRT999 1000 ml
EUR 88.00

Bradford reagent

BDE641 100ml
EUR 61.01
  • Product category: Biochemicals/Biology Reagents/Protein Related

Beaucage reagent

HY-100951 10mM/1mL
EUR 126.00

Human SRPX2 shRNA Plasmid

20-abx959053
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse SRPX2 shRNA Plasmid

20-abx976738
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Polyclonal SRPX2 Antibody (Internal)

APR13542G 0.05mg
EUR 484.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human SRPX2 (Internal). This antibody is tested and proven to work in the following applications:

Rat SRPX2 shRNA Plasmid

20-abx989971
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

SRPX2 Polyclonal Conjugated Antibody

C28966 100ul
EUR 397.00

Sheep SRPX2 ELISA Kit

ESS0181 96Tests
EUR 521.00

Porcine SRPX2 ELISA Kit

EPS0181 96Tests
EUR 521.00

Monkey SRPX2 ELISA Kit

EMKS0181 96Tests
EUR 521.00

Mouse SRPX2 ELISA Kit

EMS0181 96Tests
EUR 521.00

Rat SRPX2 ELISA Kit

ERS0181 96Tests
EUR 521.00

Rabbit SRPX2 ELISA Kit

ERTS0181 96Tests
EUR 521.00

Human SRPX2 ELISA Kit

EHS0181 96Tests
EUR 521.00

Goat SRPX2 ELISA Kit

EGTS0181 96Tests
EUR 521.00

Bovine SRPX2 ELISA Kit

EBS0181 96Tests
EUR 521.00

Chicken SRPX2 ELISA Kit

ECKS0181 96Tests
EUR 521.00

SRPX2 ELISA KIT|Human

EF003243 96 Tests
EUR 689.00

Canine SRPX2 ELISA Kit

ECS0181 96Tests
EUR 521.00

SRPX2 Recombinant Protein (Rat)

RP231089 100 ug Ask for price

SRPX2 Recombinant Protein (Human)

RP030124 100 ug Ask for price

SRPX2 Recombinant Protein (Mouse)

RP175466 100 ug Ask for price

SRPX2 Recombinant Protein (Mouse)

RP175469 100 ug Ask for price

Anti-SRPX2 Antibody (Biotin)

STJ503135 100 µg
EUR 586.00

Anti-SRPX2 Antibody (FITC)

STJ503136 100 µg
EUR 586.00

JM109-lysate Antibody

abx234439-100ug 100 ug
EUR 551.00
  • Shipped within 5-12 working days.

CMV Cell Lysate

35-1867 1 mg
EUR 1835.00
Description: CMV enriched cell lysate

HSV1 Cell Lysate

35-1872 1 ml
EUR 394.00
Description: HSV1 enriched cell lysate

HSV2 Cell Lysate

35-1873 1 ml
EUR 394.00
Description: HSV2 enriched cell lysate

Arabidopsis Thaliana Lysate

30R-AA023 150 ug
EUR 156.00
Description: Arabidopsis Thaliana Plant Lysate

BL21-lysate Antibody

abx230905-100ug 100 ug
EUR 551.00
  • Shipped within 5-12 working days.

DH5a-lysate Antibody

abx232362-100ug 100 ug
EUR 551.00
  • Shipped within 5-12 working days.

Green Algae Lysate

PABL-1306 50 ug
EUR 164.00

FcR blocking Reagent

20-abx290024
  • EUR 377.00
  • EUR 516.00
  • 200 tests
  • 400 tests
  • Shipped within 2-3 weeks.

Detection Reagent A

abx296004-120ul 120 ul
EUR 321.00
  • Shipped within 5-10 working days.

Leave a Reply

Your email address will not be published. Required fields are marked *