Antibody-protein binding and Conformational changes

Antibody-protein binding and conformational adjustments: figuring out allosteric signalling pathways to engineer a greater effector response

Quite a few monoclonal antibodies have been developed efficiently for the remedy of assorted ailments. Nonetheless, the event of biotherapeutic antibodies is complicated, costly, and time-consuming, and to facilitate this course of, cautious structural evaluation past the antibody binding web site is required to develop a extra efficacious antibody. On this work, we targeted on protein antigens, since they induce the most important antibody adjustments, and supply fascinating circumstances to check and distinction.

The constructions of 15 anti-protein antibodies have been analysed to check the antigen-bound/unbound types. Surprisingly, three completely different lessons of binding-induced adjustments have been recognized. In school (B1), the antigen binding fragment distorted considerably, and we discovered adjustments within the loop area of the heavy chain’s fixed area; this corresponds properly with anticipated allosteric actions. In school (B2), we discovered adjustments in the identical loop area with out the general distortion.

In school (B3), these adjustments didn’t current, and solely native adjustments on the complementarity figuring out areas have been discovered. Consequently, structural evaluation of antibodies is essential for therapeutic improvement. Cautious analysis of allosteric actions should be undertaken to develop higher effector responses, particularly throughout the transformation of those antibodies from small fragments on the discovery stage to full antibodies on the subsequent improvement phases.

Olfactory marker protein elevates basal cAMP focus

Olfactory marker protein (OMP), which is expressed abundantly in mature olfactory receptor neurons, operates as a cAMP-binding protein. OMP captures phasic cAMP surges induced by sensory stimuli and punctuates the downstream signalling within the cilia. Alternatively, OMP can be ample within the soma. At equilibrium, OMP ought to exhibit affiliation/dissociation reactions with cAMP.

To look at the steady-state perform of OMP, we expressed OMP in an HEK293 heterologous expression system and measured the exercise of cAMP-dependent protein kinase (PKA) utilizing a cAMP response component/luciferase reporter assay. Within the presence of OMP, the basal exercise degree of PKA was elevated to roughly twice as a lot as that within the absence of OMP. Upon tonic stimulation by membrane-permeable cAMP, the PKA exercise elevated in a dose-dependent method and was higher within the presence of OMP in any respect doses till saturation.

These outcomes point out that OMP, a cytosolic cAMP-binding protein, operates as a cAMP reservoir by will increase the basal cAMP focus and enhances tonic cAMP actions. Along with the earlier discovering that OMP acutely sequesters cAMP-related responses, these outcomes point out that OMP can buffer acute surges in cAMP and tonic manufacturing, which stabilizes the basal cAMP pool in the long term.

choleratox

Recombinant Human UPK2 Protein, His, E.coli-1mg
QP13897-1mg	EnQuireBio	1mg	EUR 2757.00

Recombinant Human UPK2 Protein, His, E.coli-20ug
QP13897-20ug	EnQuireBio	20ug	EUR 201.00

Recombinant Human UPK2 Protein, His, E.coli-5ug
QP13897-5ug	EnQuireBio	5ug	EUR 155.00

Recombinant Uroplakin 2 (UPK2)
4-RPF561Hu01	Cloud-Clone	EUR 368.80 EUR 202.00 EUR 1108.00 EUR 436.00 EUR 772.00 EUR 310.00 EUR 2620.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: O00526 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 17.4kDa Isoelectric Point: Inquire
Description: Recombinant Human Uroplakin 2 expressed in: E.coli

Human Uroplakin 2 (UPK2) Protein
20-abx650668	Abbexa	EUR 523.00 EUR 244.00 EUR 1497.00 EUR 606.00 EUR 384.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

UPK2 siRNA
20-abx939075	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

UPK2 antibody
70R-21174	Fitzgerald	50 ul	EUR 435.00
Description: Rabbit polyclonal UPK2 antibody

UPK2 Antibody
1-CSB-PA025656GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20â„ƒ, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against UPK2. Recognizes UPK2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

Uroplakin-2 (UPK2) Protein
20-abx261408	Abbexa	EUR 3418.00 EUR 328.00 EUR 230.00	1 mg 20 ug 5 ug
Shipped within 5-10 working days.

UPK2 protein (His tag)
30R-2967	Fitzgerald	100 ug	EUR 322.00
Description: Purified recombinant Human UPK2 protein (His tag)

Human UPK2 shRNA Plasmid
20-abx955048	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

UPK2 ELISA KIT\|Human
EF004088	Lifescience Market	96 Tests	EUR 689.00

Recombinant Human Uroplakin-2/UPK2 (C-6His)
CA11-10ug	Novoprotein	10ug	EUR 202.00
Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB,150mM NaCl,pH7.4.

Recombinant Human Uroplakin-2/UPK2 (C-6His)
CA11-1mg	Novoprotein	1mg	EUR 2283.00
Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB,150mM NaCl,pH7.4.

Recombinant Human Uroplakin-2/UPK2 (C-6His)
CA11-500ug	Novoprotein	500ug	EUR 1613.00
Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB,150mM NaCl,pH7.4.

Recombinant Human Uroplakin-2/UPK2 (C-6His)
CA11-50ug	Novoprotein	50ug	EUR 496.00
Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB,150mM NaCl,pH7.4.

UPK2 Rabbit pAb
A3338-100ul	Abclonal	100 ul	EUR 308.00

UPK2 Rabbit pAb
A3338-200ul	Abclonal	200 ul	EUR 459.00

UPK2 Rabbit pAb
A3338-20ul	Abclonal	20 ul	Ask for price

UPK2 Rabbit pAb
A3338-50ul	Abclonal	50 ul	Ask for price

UPK2 Rabbit pAb
A10813-100ul	Abclonal	100 ul	EUR 308.00

UPK2 Rabbit pAb
A10813-200ul	Abclonal	200 ul	EUR 459.00

UPK2 Rabbit pAb
A10813-20ul	Abclonal	20 ul	EUR 183.00

UPK2 Rabbit pAb
A10813-50ul	Abclonal	50 ul	EUR 223.00

UPK2 cloning plasmid
CSB-CL025656HU-10ug	Cusabio	10ug	EUR 233.00
Formulation: 10 Î¼g plasmid + 200Î¼l Glycerol Length: 555 Sequence: ATGGCACCCCTGCTGCCCATCCGGACCTTGCCCTTGATCCTGATTCTGCTGGCTCTGCTGTCCCCAGGGGCTGCAGACTTCAACATCTCAAGCCTCTCTGGTCTGCTGTCCCCGGCACTAACGGAGAGCCTGCTGGTTGCCTTGCCCCCCTGTCACCTCACAGGAGGCAATGCCAC Show more
Description: A cloning plasmid for the UPK2 gene.

UPK2 Polyclonal Antibody
27504-100ul	SAB	100ul	EUR 252.00

UPK2 Polyclonal Antibody
27504-50ul	SAB	50ul	EUR 187.00

Anti-UPK2 antibody
PAab09274	Lifescience Market	100 ug	EUR 386.00

anti- UPK2 antibody
FNab09274	FN Test	100µg	EUR 548.75
Recommended dilution: WB: 1:200-1:2000 IHC：1:20-1:200 Immunogen: uroplakin 2 Uniprot ID: O00526 Gene ID: 7379 Research Area: Developmental biology
Description: Antibody raised against UPK2

anti- UPK2 antibody
FNab09275	FN Test	100µg	EUR 585.00
Recommended dilution: IHC：1:20-1:200 Immunogen: uroplakin 2 Uniprot ID: O00526 Gene ID: 7379 Research Area: Developmental biology
Description: Antibody raised against UPK2

Anti-UPK2 antibody
STJ112709	St John's Laboratory	100 µl	EUR 277.00
Description: This gene encodes one of the proteins of the highly conserved urothelium-specific integral membrane proteins of the asymmetric unit membrane which forms urothelium apical plaques in mammals. The asymmetric unit membrane is believed to strengthen the urothelium by preventing cell rupture during bladder distention. The encoded protein is expressed in the peripheral blood of bladder cancer patients with transitional cell carcinomas.

Anti-UPK2 antibody
STJ26047	St John's Laboratory	100 µl	EUR 277.00
Description: This gene encodes one of the proteins of the highly conserved urothelium-specific integral membrane proteins of the asymmetric unit membrane which forms urothelium apical plaques in mammals. The asymmetric unit membrane is believed to strengthen the urothelium by preventing cell rupture during bladder distention. The encoded protein is expressed in the peripheral blood of bladder cancer patients with transitional cell carcinomas.

UPK2 ORF Vector (Human) (pORF)
ORF014895	ABM	1.0 ug DNA	EUR 354.00

UPK2 Protein Vector (Human) (pPB-C-His)
PV059577	ABM	500 ng	EUR 481.00

UPK2 Protein Vector (Human) (pPB-N-His)
PV059578	ABM	500 ng	EUR 481.00

UPK2 Protein Vector (Human) (pPM-C-HA)
PV059579	ABM	500 ng	EUR 481.00

UPK2 Protein Vector (Human) (pPM-C-His)
PV059580	ABM	500 ng	EUR 481.00

Uroplakin-2 (UPK2) Antibody
abx239274-100ug	Abbexa	100 ug	EUR 509.00
Shipped within 5-12 working days.

Mouse Uroplakin-2 (Upk2)
1-CSB-EP025656MO	Cusabio	EUR 505.00 EUR 265.00 EUR 1827.00 EUR 766.00 EUR 1218.00 EUR 335.00	100ug 10ug 1MG 200ug 500ug 50ug
MW: 40.8 kDa Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Mouse Uroplakin-2(Upk2) expressed in E.coli

Uroplakin-2 (UPK2) Antibody
20-abx002383	Abbexa	EUR 411.00 EUR 592.00	100 ul 200 ul
Shipped within 5-10 working days.

Uroplakin 2 (UPK2) Antibody
20-abx131673	Abbexa	EUR 453.00 EUR 133.00 EUR 1302.00 EUR 620.00 EUR 342.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Uroplakin-2 (UPK2) Antibody
20-abx126762	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Uroplakin 2 (UPK2) Antibody
20-abx116547	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

UPK2 Polyclonal Conjugated Antibody
C27504	SAB	100ul	EUR 397.00

Human Uroplakin 2 (UPK2) CLIA Kit
20-abx494951	Abbexa	EUR 7973.00 EUR 4246.00 EUR 981.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

Human Uroplakin 2 (UPK2) ELISA Kit
20-abx156911	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Uroplakin 2 (UPK2) Polyclonal Antibody (Human)
4-PAF561Hu01	Cloud-Clone	EUR 261.00 EUR 2734.00 EUR 676.00 EUR 330.00 EUR 220.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: UPK2 (Asp26~Thr153) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Uroplakin 2 (UPK2)

Human Uroplakin- 2, UPK2 ELISA KIT
ELI-36740h	Lifescience Market	96 Tests	EUR 824.00

UPK2 sgRNA CRISPR Lentivector set (Human)
K2591901	ABM	3 x 1.0 ug	EUR 339.00

Human Uroplakin 2(UPK2)ELISA Kit
QY-E02051	Qayee Biotechnology	96T	EUR 374.00

Human Uroplakin 2 ELISA Kit (UPK2)
RK02481	Abclonal	96 Tests	EUR 521.00

Human Uroplakin 2 (UPK2) ELISA Kit
SEF561Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4731.50
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Uroplakin 2 (UPK2) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Uroplakin 2 (UPK2) in tissue homogenates, cell lysates and other biological fluids.

Human Uroplakin 2 (UPK2) ELISA Kit
SEF561Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 477.30
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Uroplakin 2 (UPK2) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Uroplakin 2 (UPK2) in tissue homogenates, cell lysates and other biological fluids.

Human Uroplakin 2 (UPK2) ELISA Kit
SEF561Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 639.00
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Uroplakin 2 (UPK2) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Uroplakin 2 (UPK2) in tissue homogenates, cell lysates and other biological fluids.

Human Uroplakin 2 (UPK2) ELISA Kit
SEF561Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2575.50
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Uroplakin 2 (UPK2) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Uroplakin 2 (UPK2) in tissue homogenates, cell lysates and other biological fluids.

Human Uroplakin 2 (UPK2) ELISA Kit
4-SEF561Hu	Cloud-Clone	EUR 4782.00 EUR 2526.00 EUR 640.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Uroplakin 2 elisa. Alternative names of the recognized antigen: UPII Uroplakin II
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Uroplakin 2 (UPK2) in samples from tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

UPK2 Protein Vector (Rat) (pPB-C-His)
PV314586	ABM	500 ng	EUR 603.00

UPK2 Protein Vector (Rat) (pPB-N-His)
PV314587	ABM	500 ng	EUR 603.00

UPK2 Protein Vector (Rat) (pPM-C-HA)
PV314588	ABM	500 ng	EUR 603.00

UPK2 Protein Vector (Rat) (pPM-C-His)
PV314589	ABM	500 ng	EUR 603.00

UPK2 Protein Vector (Mouse) (pPB-C-His)
PV244278	ABM	500 ng	EUR 603.00

UPK2 Protein Vector (Mouse) (pPB-N-His)
PV244279	ABM	500 ng	EUR 603.00

UPK2 Protein Vector (Mouse) (pPM-C-HA)
PV244280	ABM	500 ng	EUR 603.00

UPK2 Protein Vector (Mouse) (pPM-C-His)
PV244281	ABM	500 ng	EUR 603.00

Uroplakin 2 (UPK2) Polyclonal Antibody (Human), APC
4-PAF561Hu01-APC	Cloud-Clone	EUR 367.00 EUR 3581.00 EUR 989.00 EUR 470.00 EUR 228.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: UPK2 (Asp26~Thr153) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Uroplakin 2 (UPK2). This antibody is labeled with APC.

Uroplakin 2 (UPK2) Polyclonal Antibody (Human), Biotinylated
4-PAF561Hu01-Biotin	Cloud-Clone	EUR 327.00 EUR 2684.00 EUR 783.00 EUR 403.00 EUR 225.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: UPK2 (Asp26~Thr153) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Uroplakin 2 (UPK2). This antibody is labeled with Biotin.

Uroplakin 2 (UPK2) Polyclonal Antibody (Human), Cy3
4-PAF561Hu01-Cy3	Cloud-Clone	EUR 447.00 EUR 4733.00 EUR 1277.00 EUR 585.00 EUR 263.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: UPK2 (Asp26~Thr153) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Uroplakin 2 (UPK2). This antibody is labeled with Cy3.

Uroplakin 2 (UPK2) Polyclonal Antibody (Human), FITC
4-PAF561Hu01-FITC	Cloud-Clone	EUR 313.00 EUR 2884.00 EUR 811.00 EUR 396.00 EUR 202.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: UPK2 (Asp26~Thr153) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Uroplakin 2 (UPK2). This antibody is labeled with FITC.

Uroplakin 2 (UPK2) Polyclonal Antibody (Human), HRP
4-PAF561Hu01-HRP	Cloud-Clone	EUR 334.00 EUR 3120.00 EUR 873.00 EUR 424.00 EUR 214.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: UPK2 (Asp26~Thr153) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Uroplakin 2 (UPK2). This antibody is labeled with HRP.

Uroplakin 2 (UPK2) Polyclonal Antibody (Human), PE
4-PAF561Hu01-PE	Cloud-Clone	EUR 313.00 EUR 2884.00 EUR 811.00 EUR 396.00 EUR 202.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: UPK2 (Asp26~Thr153) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Uroplakin 2 (UPK2). This antibody is labeled with PE.

ELISA kit for Human UPK2 (Uroplakin 2)
ELK5223	ELK Biotech	1 plate of 96 wells	EUR 432.00
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Uroplakin 2 (UPK2). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Uroplakin 2 (UP Show more
Description: A sandwich ELISA kit for detection of Uroplakin 2 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

UPK2 sgRNA CRISPR Lentivector (Human) (Target 1)
K2591902	ABM	1.0 ug DNA	EUR 154.00

UPK2 sgRNA CRISPR Lentivector (Human) (Target 2)
K2591903	ABM	1.0 ug DNA	EUR 154.00

UPK2 sgRNA CRISPR Lentivector (Human) (Target 3)
K2591904	ABM	1.0 ug DNA	EUR 154.00

Uroplakin 2 (UPK2) Antibody (Cy3)
20-abx274287	Abbexa	EUR 592.00 EUR 286.00 EUR 1887.00 EUR 857.00 EUR 467.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-12 working days.

Upk2 ORF Vector (Rat) (pORF)
ORF078647	ABM	1.0 ug DNA	EUR 506.00

Upk2 ORF Vector (Mouse) (pORF)
ORF061070	ABM	1.0 ug DNA	EUR 506.00

Uroplakin 2 (UPK2) Polyclonal Antibody (Human), APC-Cy7
4-PAF561Hu01-APC-Cy7	Cloud-Clone	EUR 614.00 EUR 7042.00 EUR 1858.00 EUR 821.00 EUR 337.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: UPK2 (Asp26~Thr153) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Uroplakin 2 (UPK2). This antibody is labeled with APC-Cy7.

Porcine Uroplakin- 2, UPK2 ELISA KIT
ELI-39864p	Lifescience Market	96 Tests	EUR 928.00

Bovine Uroplakin- 2, UPK2 ELISA KIT
ELI-28839b	Lifescience Market	96 Tests	EUR 928.00

Mouse Uroplakin- 2, Upk2 ELISA KIT
ELI-36741m	Lifescience Market	96 Tests	EUR 865.00

Plasma vascular adhesion protein-1 ranges correlate positively with frailty severity in older adults

Geriatric frailty is related to elevated mortality and hyperlinks to elevated inflammatory exercise. Vascular adhesion protein-1 (VAP-1) is necessary in inflammatory course of. This examine investigates the connection between plasma VAP-1 degree and frailty in older adults.

The cross-sectional examine recruited group dwelling older adults from a hospital-based complete geriatric evaluation program. The demographic knowledge, Fried Frailty Index, metabolic and inflammatory parameters have been assessed.

A complete of 151 contributors (76 girls, 50.3%) have been included within the evaluation, and the age (imply ± normal deviation) was 77.1 ± 6.1 years. The imply plasma VAP-1 degree (ng/mL) was considerably completely different (P = .029) amongst completely different frailty teams (346.3 ± 86.5 within the sturdy older adults, 371.6 ± 107.9 within the pre-frail older adults, and 416.6 ± 141.

1 within the frail older adults). Multivariate ordered logistic regression evaluation additionally demonstrated that plasma VAP-1 ranges have been positively related to frailty severity (P = .039). Evaluation of the frailty parts with plasma VAP-1 ranges confirmed that the aged who had “exhaustion” (P = .016) or “weak spot” (P = .025) tended to have greater plasma VAP-1 ranges.The information help that VAP-1 may symbolize a possible plasma biomarker of frailty.

Optogenetic management of protein binding utilizing light-switchable nanobodies

A rising variety of optogenetic instruments have been developed to reversibly management binding between two engineered protein domains. In distinction, comparatively few instruments confer light-switchable binding to a generic goal protein of curiosity.

Such a functionality would provide substantial benefits, enabling photoswitchable binding to endogenous goal proteins in cells or light-based protein purification in vitro. Right here, we report the event of opto-nanobodies (OptoNBs), a flexible class of chimeric photoswitchable proteins whose binding to proteins of curiosity may be enhanced or inhibited upon blue mild illumination.

We discover that OptoNBs are appropriate for a spread of functions together with reversibly binding to endogenous intracellular targets, modulating signaling pathway exercise, and controlling binding to purified protein targets in vitro. This work represents a step in the direction of programmable photoswitchable regulation of all kinds of goal proteins.

Human Prion Protein (PRNP) ELISA Kit
DL-PRNP-Hu-96	DLdevelop	1 kit of 96 tests	EUR 621.00
Description: An ELISA kit based on the sandwich method for detection and quantification of Human Prion Protein (PRNP)

Mouse Prion Protein (PRNP) ELISA Kit
DL-PRNP-Mu-192	DLdevelop	1 kit of 192 tests	EUR 1130.00
Description: An ELISA kit based on the sandwich method for detection and quantification of Mouse Prion Protein (PRNP)

Mouse Prion Protein (PRNP) ELISA Kit
DL-PRNP-Mu-48	DLdevelop	1 kit of 48 tests	EUR 474.00
Description: An ELISA kit based on the sandwich method for detection and quantification of Mouse Prion Protein (PRNP)

Mouse Prion Protein (PRNP) ELISA Kit
DL-PRNP-Mu-96	DLdevelop	1 kit of 96 tests	EUR 635.00
Description: An ELISA kit based on the sandwich method for detection and quantification of Mouse Prion Protein (PRNP)

Mouse Prion Protein (PRNP) ELISA Kit
DLR-PRNP-Mu-48T	DL Develop	48T	EUR 508.00
Should the Mouse Prion Protein (PRNP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Prion Protein (PRNP) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Prion Protein (PRNP) ELISA Kit
RD-PRNP-Hu-48Tests	Reddot Biotech	48 Tests	EUR 500.00

Human Prion Protein (PRNP) ELISA Kit
RD-PRNP-Hu-96Tests	Reddot Biotech	96 Tests	EUR 692.00

Mouse Prion Protein (PRNP) ELISA Kit
RD-PRNP-Mu-48Tests	Reddot Biotech	48 Tests	EUR 511.00

Mouse Prion Protein (PRNP) ELISA Kit
RD-PRNP-Mu-96Tests	Reddot Biotech	96 Tests	EUR 709.00

Human Prion Protein (PRNP) ELISA Kit
RDR-PRNP-Hu-48Tests	Reddot Biotech	48 Tests	EUR 522.00

Human Prion Protein (PRNP) ELISA Kit
RDR-PRNP-Hu-96Tests	Reddot Biotech	96 Tests	EUR 724.00

Mouse Prion Protein (PRNP) ELISA Kit
RDR-PRNP-Mu-48Tests	Reddot Biotech	48 Tests	EUR 534.00

Mouse Prion Protein (PRNP) ELISA Kit
RDR-PRNP-Mu-96Tests	Reddot Biotech	96 Tests	EUR 742.00

Prion Protein (PRNP) Antibody
abx431521-200ul	Abbexa	200 ul	EUR 384.00
Shipped within 1-3 working days.

Prion Protein (PRNP) Antibody
20-abx101113	Abbexa	EUR 411.00 EUR 133.00 EUR 1149.00 EUR 565.00 EUR 314.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Prion Protein (PRNP) Antibody
20-abx101114	Abbexa	EUR 425.00 EUR 133.00 EUR 1177.00 EUR 578.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Prion Protein (PRNP) Antibody
20-abx174157	Abbexa	EUR 815.00 EUR 425.00	1 mg 200 ug
Please enquire.

Prion Protein (PRNP) Antibody
abx120079-01ml	Abbexa	0.1 ml	EUR 1483.00
Shipped within 5-10 working days.

Prion Protein (PRNP) Antibody
20-abx114678	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

Anti-Prion protein PrP/PRNP Antibody
PB9783	BosterBio	100ug/vial	EUR 334.00

Anti-Prion protein PrP/PRNP Antibody
PA1794	BosterBio	100ug/vial	EUR 294.00

Anti-Prion protein PrP/PRNP Antibody
PA1795	BosterBio	100ug/vial	EUR 334.00

Major Prion Protein (PRNP) Antibody
20-abx319681	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Major Prion Protein (PRNP) Antibody
20-abx333875	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Prion Protein (PRNP) Antibody Pair
20-abx370619	Abbexa	EUR 1887.00 EUR 1191.00	10 × 96 tests 5 × 96 tests
Shipped within 5-15 working days.

Prion Protein (PRNP) Antibody Pair
20-abx370620	Abbexa	EUR 1706.00 EUR 1094.00	10 × 96 tests 5 × 96 tests
Shipped within 5-15 working days.

Prion Protein (PRNP) Antibody Pair
20-abx370621	Abbexa	EUR 1664.00 EUR 1066.00	10 × 96 tests 5 × 96 tests
Shipped within 5-15 working days.

Major Prion Protein (PRNP) Antibody
20-abx002019	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Recombinant Prion Protein (PRNP)
4-RPB680Hu01	Cloud-Clone	EUR 490.66 EUR 234.00 EUR 1564.96 EUR 588.32 EUR 1076.64 EUR 391.00 EUR 3762.40	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: P04156 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 26.6kDa Isoelectric Point: 9.5
Description: Recombinant Human Prion Protein expressed in: E.coli

Recombinant Prion Protein (PRNP)
4-RPB680Mu01	Cloud-Clone	EUR 512.16 EUR 240.00 EUR 1645.60 EUR 615.20 EUR 1130.40 EUR 406.00 EUR 3964.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: P04925 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 26.8kDa Isoelectric Point: 9.6
Description: Recombinant Mouse Prion Protein expressed in: E.coli

Major Prion Protein (PRNP) Protein
20-abx263341	Abbexa	EUR 1609.00 EUR 328.00 EUR 230.00	100 ug 10 ug 2 µg
Shipped within 5-10 working days.

Mouse Prion Protein (PRNP) Protein
20-abx068666	Abbexa	EUR 718.00 EUR 286.00 EUR 2221.00 EUR 857.00 EUR 509.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Human Prion Protein (PRNP) Protein
20-abx068667	Abbexa	EUR 690.00 EUR 286.00 EUR 2110.00 EUR 815.00 EUR 495.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Major Prion Protein (PRNP) Antibody (HRP)
20-abx319682	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Major Prion Protein (PRNP) Antibody (FITC)
20-abx319683	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Major Prion Protein (PRNP) Antibody (Biotin)
20-abx319684	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Major Prion Protein (PRNP) Antibody (HRP)
20-abx336435	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Major Prion Protein (PRNP) Antibody (FITC)
20-abx336436	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Major Prion Protein (PRNP) Antibody (Biotin)
20-abx336437	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Rat Major prion protein (Prnp)
1-CSB-YP018739RA	Cusabio	EUR 504.00 EUR 265.00 EUR 1832.00 EUR 763.00 EUR 1216.00 EUR 334.00	100ug 10ug 1MG 200ug 500ug 50ug
MW: 24.3 kDa Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Rat Major prion protein(Prnp) expressed in Yeast

Rat Major prion protein (Prnp)
1-CSB-EP018739RA	Cusabio	EUR 505.00 EUR 265.00 EUR 1827.00 EUR 766.00 EUR 1218.00 EUR 335.00	100ug 10ug 1MG 200ug 500ug 50ug
MW: 26.3 kDa Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Rat Major prion protein(Prnp) expressed in E.coli

PRNP Prion Protein Human Recombinant Protein
PROTP04156	BosterBio	Regular: 10ug	EUR 317.00
Description: PRNP Human Recombinant produced in E.Coli is a single, non-glycosylated polypeptide chain containing 229 amino acids (23-230a.a) and having a molecular mass of 25kDa. GOSR2 is fused to a 21 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.

Prion Protein (PRNP) Polyclonal Antibody (Rat, Mouse)
4-PAB680Hu01	Cloud-Clone	EUR 239.00 EUR 2391.00 EUR 598.00 EUR 299.00 EUR 211.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PRNP (Lys23~Ser230) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Rat, Mouse Prion Protein (PRNP)

Prion Protein (PRNP) Polyclonal Antibody (Mouse, Rat)
4-PAB680Mu01	Cloud-Clone	EUR 243.00 EUR 2457.00 EUR 613.00 EUR 305.00 EUR 212.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PRNP (Lys23~Ser230) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse, Rat Prion Protein (PRNP)

Human Prion Protein (PRNP) CLIA Kit
20-abx492982	Abbexa	EUR 7973.00 EUR 4246.00 EUR 981.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

Mouse Prion Protein (PRNP) CLIA Kit
20-abx492983	Abbexa	EUR 8569.00 EUR 4560.00 EUR 1052.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

Rat Prion Protein (PRNP) CLIA Kit
20-abx496530	Abbexa	EUR 8569.00 EUR 4560.00 EUR 1052.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

Cow Prion Protein (PRNP) ELISA Kit
abx521103-96tests	Abbexa	96 tests	EUR 911.00
Shipped within 5-12 working days.

Chicken Prion Protein (PRNP) ELISA Kit
abx521104-96tests	Abbexa	96 tests	EUR 911.00
Shipped within 5-12 working days.

Dog Prion Protein (PRNP) ELISA Kit
abx521105-96tests	Abbexa	96 tests	EUR 911.00
Shipped within 5-12 working days.

Pig Prion Protein (PRNP) ELISA Kit
abx521108-96tests	Abbexa	96 tests	EUR 911.00
Shipped within 5-12 working days.

Rat Prion Protein (PRNP) ELISA Kit
abx521109-96tests	Abbexa	96 tests	EUR 668.00
Shipped within 5-12 working days.

Mouse Prion Protein (PRNP) ELISA Kit
abx571234-96tests	Abbexa	96 tests	EUR 668.00
Shipped within 5-12 working days.

Human Prion Protein (PRNP) ELISA Kit
abx573091-96tests	Abbexa	96 tests	EUR 668.00
Shipped within 5-12 working days.

Mouse Prion Protein (PRNP) ELISA Kit
abx255159-96tests	Abbexa	96 tests	EUR 746.00
Shipped within 5-12 working days.

Human Prion Protein (PRNP) ELISA Kit
abx251835-96tests	Abbexa	96 tests	EUR 746.00
Shipped within 5-12 working days.

Rat Prion Protein (PRNP) ELISA Kit
20-abx258974	Abbexa	EUR 7237.00 EUR 3855.00 EUR 895.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Prion Protein (PRNP) ELISA Kit
20-abx156738	Abbexa	EUR 7112.00 EUR 3792.00 EUR 879.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Mouse Prion Protein (PRNP) ELISA Kit
20-abx156832	Abbexa	EUR 7237.00 EUR 3855.00 EUR 895.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Prion Protein(PRNP)ELISA Kit
QY-E01716	Qayee Biotechnology	96T	EUR 361.00

Human Prion Protein ELISA Kit (PRNP)
RK02138	Abclonal	96 Tests	EUR 521.00

Mouse Prion Protein ELISA Kit (PRNP)
RK03137	Abclonal	96 Tests	EUR 521.00

Human Prion Protein (PRNP) ELISA Kit
SEB680Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4502.43
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Prion Protein (PRNP) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Prion Protein (PRNP) in tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Prion Protein (PRNP) ELISA Kit
SEB680Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 458.44
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Prion Protein (PRNP) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Prion Protein (PRNP) in tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Prion Protein (PRNP) ELISA Kit
SEB680Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 612.05
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Prion Protein (PRNP) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Prion Protein (PRNP) in tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Prion Protein (PRNP) ELISA Kit
SEB680Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2454.23
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Prion Protein (PRNP) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Prion Protein (PRNP) in tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Prion Protein (PRNP) ELISA Kit
4-SEB680Hu	Cloud-Clone	EUR 4553.00 EUR 2405.00 EUR 613.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Prion Protein elisa. Alternative names of the recognized antigen: CD230 GSS ASCR CJD PRIP PrP PrP2730 PrPc Major prion protein Creutzfeldt-Jakob Disease Gerstmann-Strausler-Scheinker Syndrome Fatal Familial Insomnia
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Prion Protein (PRNP) in samples from tissue homogenates, cell lysates, cell culture supernates and other biological fluids with no significant corss-reactivity with analogues from other species.

Mouse Prion Protein (PRNP) ELISA Kit
SEB680Mu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4626.78
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Prion Protein (PRNP) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Prion Protein (PRNP) in tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Mouse Prion Protein (PRNP) ELISA Kit
SEB680Mu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 468.68
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Prion Protein (PRNP) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Prion Protein (PRNP) in tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Mouse Prion Protein (PRNP) ELISA Kit
SEB680Mu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 626.68
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Prion Protein (PRNP) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Prion Protein (PRNP) in tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Mouse Prion Protein (PRNP) ELISA Kit
SEB680Mu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2520.06
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Prion Protein (PRNP) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Prion Protein (PRNP) in tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Mouse Prion Protein (PRNP) ELISA Kit
4-SEB680Mu	Cloud-Clone	EUR 4677.00 EUR 2471.00 EUR 627.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Prion Protein elisa. Alternative names of the recognized antigen: CD230 GSS ASCR CJD PRIP PrP PrP2730 PrPc Major prion protein Creutzfeldt-Jakob Disease Gerstmann-Strausler-Scheinker Syndrome Fatal Familial Insomnia
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse Prion Protein (PRNP) in samples from tissue homogenates, cell lysates, cell culture supernates and other biological fluids with no significant corss-reactivity with analogues from other species.

Rat Prion Protein (PRNP) ELISA Kit
SEB680Ra-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 5124.20
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Prion Protein (PRNP) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Prion Protein (PRNP) in tissue homogenates, cell lysates and other biological fluids.

Rat Prion Protein (PRNP) ELISA Kit
SEB680Ra-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 509.64
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Prion Protein (PRNP) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Prion Protein (PRNP) in tissue homogenates, cell lysates and other biological fluids.

Rat Prion Protein (PRNP) ELISA Kit
SEB680Ra-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 685.20
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Prion Protein (PRNP) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Prion Protein (PRNP) in tissue homogenates, cell lysates and other biological fluids.

Rat Prion Protein (PRNP) ELISA Kit
SEB680Ra-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2783.40
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Prion Protein (PRNP) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Prion Protein (PRNP) in tissue homogenates, cell lysates and other biological fluids.

Rat Prion Protein (PRNP) ELISA Kit
4-SEB680Ra	Cloud-Clone	EUR 5175.00 EUR 2734.00 EUR 686.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Prion Protein elisa. Alternative names of the recognized antigen: CD230 GSS ASCR CJD PRIP PrP PrP2730 PrPc Major prion protein Creutzfeldt-Jakob Disease Gerstmann-Strausler-Scheinker Syndrome Fatal Familial Insomnia
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Rat Prion Protein (PRNP) in samples from tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

Prion Protein (PRNP) Polyclonal Antibody (Rat, Mouse), APC
4-PAB680Hu01-APC	Cloud-Clone	EUR 333.00 EUR 3113.00 EUR 872.00 EUR 423.00 EUR 215.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PRNP (Lys23~Ser230) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Rat, Mouse Prion Protein (PRNP). This antibody is labeled with APC.

Prion Protein (PRNP) Polyclonal Antibody (Rat, Mouse), Biotinylated
4-PAB680Hu01-Biotin	Cloud-Clone	EUR 303.00 EUR 2341.00 EUR 697.00 EUR 369.00 EUR 216.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PRNP (Lys23~Ser230) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Rat, Mouse Prion Protein (PRNP). This antibody is labeled with Biotin.

Prion Protein (PRNP) Polyclonal Antibody (Rat, Mouse), Cy3
4-PAB680Hu01-Cy3	Cloud-Clone	EUR 403.00 EUR 4109.00 EUR 1121.00 EUR 523.00 EUR 245.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PRNP (Lys23~Ser230) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Rat, Mouse Prion Protein (PRNP). This antibody is labeled with Cy3.

Prion Protein (PRNP) Polyclonal Antibody (Rat, Mouse), FITC
4-PAB680Hu01-FITC	Cloud-Clone	EUR 287.00 EUR 2510.00 EUR 717.00 EUR 359.00 EUR 192.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PRNP (Lys23~Ser230) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Rat, Mouse Prion Protein (PRNP). This antibody is labeled with FITC.

Prion Protein (PRNP) Polyclonal Antibody (Rat, Mouse), HRP
4-PAB680Hu01-HRP	Cloud-Clone	EUR 305.00 EUR 2714.00 EUR 772.00 EUR 383.00 EUR 203.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PRNP (Lys23~Ser230) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Rat, Mouse Prion Protein (PRNP). This antibody is labeled with HRP.

Prion Protein (PRNP) Polyclonal Antibody (Rat, Mouse), PE
4-PAB680Hu01-PE	Cloud-Clone	EUR 287.00 EUR 2510.00 EUR 717.00 EUR 359.00 EUR 192.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PRNP (Lys23~Ser230) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Rat, Mouse Prion Protein (PRNP). This antibody is labeled with PE.

Prion Protein (PRNP) Polyclonal Antibody (Mouse, Rat), APC
4-PAB680Mu01-APC	Cloud-Clone	EUR 340.00 EUR 3203.00 EUR 894.00 EUR 432.00 EUR 217.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PRNP (Lys23~Ser230) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse, Rat Prion Protein (PRNP). This antibody is labeled with APC.

Prion Protein (PRNP) Polyclonal Antibody (Mouse, Rat), Biotinylated
4-PAB680Mu01-Biotin	Cloud-Clone	EUR 307.00 EUR 2407.00 EUR 714.00 EUR 375.00 EUR 217.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PRNP (Lys23~Ser230) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse, Rat Prion Protein (PRNP). This antibody is labeled with Biotin.

Prion Protein (PRNP) Polyclonal Antibody (Mouse, Rat), Cy3
4-PAB680Mu01-Cy3	Cloud-Clone	EUR 411.00 EUR 4229.00 EUR 1151.00 EUR 535.00 EUR 248.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PRNP (Lys23~Ser230) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse, Rat Prion Protein (PRNP). This antibody is labeled with Cy3.

Prion Protein (PRNP) Polyclonal Antibody (Mouse, Rat), FITC
4-PAB680Mu01-FITC	Cloud-Clone	EUR 292.00 EUR 2582.00 EUR 735.00 EUR 366.00 EUR 194.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PRNP (Lys23~Ser230) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse, Rat Prion Protein (PRNP). This antibody is labeled with FITC.

Prion Protein (PRNP) Polyclonal Antibody (Mouse, Rat), HRP
4-PAB680Mu01-HRP	Cloud-Clone	EUR 311.00 EUR 2792.00 EUR 791.00 EUR 391.00 EUR 205.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PRNP (Lys23~Ser230) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse, Rat Prion Protein (PRNP). This antibody is labeled with HRP.

Prion Protein (PRNP) Polyclonal Antibody (Mouse, Rat), PE
4-PAB680Mu01-PE	Cloud-Clone	EUR 292.00 EUR 2582.00 EUR 735.00 EUR 366.00 EUR 194.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PRNP (Lys23~Ser230) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse, Rat Prion Protein (PRNP). This antibody is labeled with PE.

Bovine Major prion protein(PRNP) ELISA kit
CSB-EL018739BO-24T	Cusabio	1 plate of 24 wells	EUR 165.00
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Bovine Major prion protein (PRNP) in samples from serum, plasma, tissue homogenates, cell lysates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Bovine Major prion protein(PRNP) ELISA kit
1-CSB-EL018739BO	Cusabio	EUR 900.00 EUR 5476.00 EUR 2900.00	1 plate of 96 wells 10 plates of 96 wells each 5 plates of 96 wells each
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Bovine Major prion protein(PRNP) in samples from serum, plasma, tissue homogenates, cell lysates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Antibody-protein binding and conformational adjustments: figuring out allosteric signalling pathways to engineer a greater effector response

Olfactory marker protein elevates basal cAMP focus

Recombinant Human UPK2 Protein, His, E.coli-1mg

Recombinant Human UPK2 Protein, His, E.coli-20ug

Recombinant Human UPK2 Protein, His, E.coli-5ug

Recombinant Uroplakin 2 (UPK2)

Human Uroplakin 2 (UPK2) Protein

UPK2 siRNA

UPK2 antibody

UPK2 Antibody

Uroplakin-2 (UPK2) Protein

UPK2 protein (His tag)

Human UPK2 shRNA Plasmid

UPK2 ELISA KIT|Human

Recombinant Human Uroplakin-2/UPK2 (C-6His)

Recombinant Human Uroplakin-2/UPK2 (C-6His)

Recombinant Human Uroplakin-2/UPK2 (C-6His)

Recombinant Human Uroplakin-2/UPK2 (C-6His)

UPK2 Rabbit pAb

UPK2 Rabbit pAb

UPK2 Rabbit pAb

UPK2 Rabbit pAb

UPK2 Rabbit pAb

UPK2 Rabbit pAb

UPK2 Rabbit pAb

UPK2 Rabbit pAb

UPK2 cloning plasmid

UPK2 Polyclonal Antibody

UPK2 Polyclonal Antibody

Anti-UPK2 antibody

anti- UPK2 antibody

anti- UPK2 antibody

Anti-UPK2 antibody

Anti-UPK2 antibody

UPK2 ORF Vector (Human) (pORF)

UPK2 Protein Vector (Human) (pPB-C-His)

UPK2 Protein Vector (Human) (pPB-N-His)

UPK2 Protein Vector (Human) (pPM-C-HA)

UPK2 Protein Vector (Human) (pPM-C-His)

Uroplakin-2 (UPK2) Antibody

Mouse Uroplakin-2 (Upk2)

Uroplakin-2 (UPK2) Antibody

Uroplakin 2 (UPK2) Antibody

Uroplakin-2 (UPK2) Antibody

Uroplakin 2 (UPK2) Antibody

UPK2 Polyclonal Conjugated Antibody

Human Uroplakin 2 (UPK2) CLIA Kit

Human Uroplakin 2 (UPK2) ELISA Kit

Uroplakin 2 (UPK2) Polyclonal Antibody (Human)

Human Uroplakin- 2, UPK2 ELISA KIT

UPK2 sgRNA CRISPR Lentivector set (Human)

Human Uroplakin 2(UPK2)ELISA Kit

Human Uroplakin 2 ELISA Kit (UPK2)

Human Uroplakin 2 (UPK2) ELISA Kit

Human Uroplakin 2 (UPK2) ELISA Kit

Human Uroplakin 2 (UPK2) ELISA Kit

Human Uroplakin 2 (UPK2) ELISA Kit

Human Uroplakin 2 (UPK2) ELISA Kit

UPK2 Protein Vector (Rat) (pPB-C-His)

UPK2 Protein Vector (Rat) (pPB-N-His)

UPK2 Protein Vector (Rat) (pPM-C-HA)

UPK2 Protein Vector (Rat) (pPM-C-His)

UPK2 Protein Vector (Mouse) (pPB-C-His)

UPK2 Protein Vector (Mouse) (pPB-N-His)

UPK2 Protein Vector (Mouse) (pPM-C-HA)

UPK2 Protein Vector (Mouse) (pPM-C-His)

Uroplakin 2 (UPK2) Polyclonal Antibody (Human), APC

Uroplakin 2 (UPK2) Polyclonal Antibody (Human), Biotinylated

Uroplakin 2 (UPK2) Polyclonal Antibody (Human), Cy3

Uroplakin 2 (UPK2) Polyclonal Antibody (Human), FITC

Uroplakin 2 (UPK2) Polyclonal Antibody (Human), HRP

Uroplakin 2 (UPK2) Polyclonal Antibody (Human), PE

ELISA kit for Human UPK2 (Uroplakin 2)

UPK2 sgRNA CRISPR Lentivector (Human) (Target 1)

UPK2 sgRNA CRISPR Lentivector (Human) (Target 2)

UPK2 sgRNA CRISPR Lentivector (Human) (Target 3)

Uroplakin 2 (UPK2) Antibody (Cy3)

Upk2 ORF Vector (Rat) (pORF)

Upk2 ORF Vector (Mouse) (pORF)

Uroplakin 2 (UPK2) Polyclonal Antibody (Human), APC-Cy7