Protein misfolded oligomers from cell membranes and abrogates their cytotoxicity


Trodusquemine displaces protein misfolded oligomers from cell membranes and abrogates their cytotoxicity through a generic mechanism


The onset and progression of numerous protein misfolding diseases are associated with the presence of oligomers formed during the aberrant aggregation of several different proteins, including amyloid-β (Aβ) in Alzheimer’s disease and α-synuclein (αS) in Parkinson’s disease.
These small, soluble aggregates are currently major targets for drug discovery. In this study, we show that trodusquemine, a naturally-occurring aminosterol, markedly reduces the cytotoxicity of αS, Aβ and HypF-N oligomers to human neuroblastoma cells by displacing the oligomers from cell membranes in the absence of any substantial morphological and structural changes to the oligomers.
These results indicate that the reduced toxicity results from a mechanism that is common to oligomers from different proteins, shed light on the origin of the toxicity of the most deleterious species associated with protein aggregation and suggest that aminosterols have the therapeutically-relevant potential to protect cells from the oligomer-induced cytotoxicity associated with numerous protein misfolding diseases.

Comparing supermarket loyalty card data with traditional diet survey data for understanding how protein is purchased and consumed in older adults for the UK, 2014-16

Background: Our ability to understand population-level dietary intake patterns is dependent on having access to high quality data. Diet surveys are common diet assessment methods, but can be limited by bias associated with under-reporting.
Food purchases tracked using supermarket loyalty card records may supplement traditional surveys, however they are rarely available to academics and policy makers. The aim of our study is to explore population level patterns of protein purchasing and consumption in ageing adults (40 years onwards).
Methods: We used diet survey data from the National Diet and Nutrition Survey (2014-16) on food consumption, and loyalty card records on food purchases from a major high street supermarket retailer (2016-17) covering the UK. We computed the percentage of total energy derived from protein, protein intake per kg of body mass, and percentage of protein acquired by food type.
Results: We found that protein consumption (as the percentage of total energy purchased) increased between ages 40-65 years, and declined thereafter. In comparison, protein purchased in supermarkets was roughly 2-2.5 percentage points lower at each year of age.
The proportion of adults meeting recommended levels of protein was lowest in age groups 55-69 and 70+. The time of protein consumption was skewed towards evening meals, with low intakes during breakfast or between main meals. Meat, fish and poultry dominated as sources of protein purchased and consumed, although adults also acquired a large share of their protein from dairy and bread, with little from plant protein.
Conclusions: Our study provides novel insights into how protein is purchased and consumed by ageing adults in the UK. Supermarket loyalty card data can reveal patterns of protein purchasing that when combined with traditional sources of dietary intake may enhance our understanding of dietary behaviors.
Keywords: Big data; Diet surveys; Population; Protein; Supermarket loyalty cards.


Anti-EBV-EBNA1 antibody

STJ16101052 100 µg
EUR 354

Recombinant EBV EBNA1 Protein, His, E.coli-100ug

QP11731-100ug 100ug
EUR 318

Recombinant EBV EBNA1 Protein, His, E.coli-1mg

QP11731-1mg 1mg
EUR 1561

Recombinant EBV EBNA1 Protein, His, E.coli-500ug

QP11731-500ug 500ug
EUR 862

Recombinant EBV EBNA1 Mosaic Protein, His, E.coli-100ug

QP11732-100ug 100ug
EUR 218

Recombinant EBV EBNA1 Mosaic Protein, His, E.coli-1mg

QP11732-1mg 1mg
EUR 1061

Recombinant EBV EBNA1 Mosaic Protein, His, E.coli-500ug

QP11732-500ug 500ug
EUR 663

EBNA1 protein

30-1925 500 ug
EUR 565
Description: Purified Recombinant EBNA1 protein

Recombinant EBV EBNA1 Mosaic Protein (aa 1-90 & 408-498) [His]

VAng-2528Lsx-100g 100 µg
EUR 463
Description: EBV EBNA1 Mosaic protein, His tag at C-terminus, recombinant protein from E. coli.

Recombinant EBV EBNA1 Mosaic Protein (aa 1-90 & 408-498) [His]

VAng-2528Lsx-1mg 1 mg
EUR 2800
Description: EBV EBNA1 Mosaic protein, His tag at C-terminus, recombinant protein from E. coli.

Recombinant EBV EBNA1 Mosaic Protein (aa 1-90 & 408-498) [His]

VAng-2528Lsx-500g 500 µg
EUR 1700
Description: EBV EBNA1 Mosaic protein, His tag at C-terminus, recombinant protein from E. coli.

Recombinant EBV EBNA1 Mosaic Protein (aa 1-90 & 408-498) [GST]

VAng-Lsx0111-100g 100 µg
EUR 633
Description: EBV EBNA1 Mosaic protein [GST], recombinant protein from E. coli.

Recombinant EBV EBNA1 Mosaic Protein (aa 1-90 & 408-498) [GST]

VAng-Lsx0111-500g 500 µg
EUR 2016
Description: EBV EBNA1 Mosaic protein [GST], recombinant protein from E. coli.


PVT10196 2 ug
EUR 301

Recombinant (E.Coli, GST tag) Epstein-Barr Virus (EBV/HHV-4) Mosaic EBNA1

RP-347 100 ug
EUR 286

EBNA1 protein (His tag)

80-1340 100 ug
EUR 241
Description: Purified recombinant EBNA1 protein (His tag)

Recombinant EBNA1 Protein [GST]

VAng-Lsx0122-100g 100 µg
EUR 682
Description: EBNA1 (EBV) (P03211) partial recombinant protein with GST tag expressed in E. coli.

EBV protein

30-1275 1 mg
EUR 3481
Description: Purified recombinant EBV protein

EBV protein

30-1276 1 mg
EUR 3481
Description: Purified recombinant EBV protein

EBV Protein

abx069822-1ml 1 ml
EUR 690
  • Shipped within 5-10 working days.

EBV Protein

abx069824-1mg 1 mg
EUR 1469
  • Shipped within 5-10 working days.

EBV Protein

abx069825-1ml 1 ml
EUR 314
  • Shipped within 5-10 working days.

EBV Protein

abx069828-1mg 1 mg
EUR 1817
  • Shipped within 5-10 working days.

EBV Protein

abx069829-1mg 1 mg
EUR 1776
  • Shipped within 5-10 working days.

EBNA1 Binding Protein 2 Protein

  • EUR 3418.00
  • EUR 328.00
  • EUR 230.00
  • 1 mg
  • 20 ug
  • 5 ug
  • Shipped within 5-10 working days.

pCXWB- EBNA1 Plasmid

PVT7175 2 ug
EUR 266

EBV EA protein

30R-AE005 100 ug
EUR 327
Description: Purified recombinant EBV EA protein

EBV p18 protein

30R-AE007 500 ug
EUR 806
Description: Purified recombinant EBV p18 protein

EBV p23 protein

30R-AE008 100 ug
EUR 327
Description: Purified recombinant EBV p23 protein

EBV EA protein

30-1280 1 mg
EUR 3481
Description: Purified recombinant EBV EA protein

EBV VCA protein

30-1811 1 ml
EUR 381
Description: Purified native EBV VCA gp125 protein

EBV EA protein

30-1920 1 ml
EUR 414
Description: Viral lysate containing a high concentration of EBV antigens, including VCA, EBNA, EA-D and EA-R

EBV EBNA protein

30-AE46 200 ug
EUR 750
Description: Purified recombinant EBV EBNA protein

EBV EA protein

30-AE50 200 ug
EUR 813
Description: Purified recombinant EBV EA protein

Recombinant EBV Protein

VAng-Lsx0108-inquire inquire Ask for price
Description: EBV, recombinant protein from human cells.

EBNA1 (GFP-Puro) Lentivirus

LVP1134-GP 1x107 IFU/ml x 200ul
EUR 349
Description: Premade lentivirus expressing Epstein Barr Virus' EBNA1 gene under EF1a promoter, containing GFP-Puromycin dual marker.

EBNA1 (RFP-Bsd) Lentivirus

LVP1134-RB 1x107 IFU/ml x 200ul
EUR 349
Description: Premade lentivirus expressing Epstein Barr Virus' EBNA1 gene under EF1a promoter, containing RFP-Blasticidin dual marker.

EBNA1 Binding Protein 2 (EBNA1BP2) Antibody

abx026949-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

EBNA1 Binding Protein 2 (EBNA1BP2) Antibody

abx026949-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

EBNA1 Binding Protein 2 (EBNA1BP2) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

EBV antibody

10-E40C 200 ug
EUR 229
Description: Mouse monoclonal EBV antibody

EBV antibody

10-E40D 200 ug
EUR 136
Description: Mouse monoclonal EBV antibody

EBV antibody

10-E40E 200 ug
EUR 212
Description: Mouse monoclonal EBV antibody

EBV [His]

DAG1578 100 µg
EUR 810


DAG1580 100 µg
EUR 645


DAG1581 100 µg
EUR 810

EBV [His]

DAG1584 100 µg
EUR 810

EBV Virus

G229 10 ml
EUR 735

EBV P18 Mosaic protein

DAG1582 100 µg
EUR 645

EBV VCA p23 Protein

abx069823-1mg 1 mg
EUR 1497
  • Shipped within 5-10 working days.

Recombinant EBV Protein [His]

VAng-Lsx0112-inquire inquire Ask for price
Description: EBV [His], recombinant protein from E. coli.

Recombinant EBV P125 Protein

VAng-Lsx0119-1mL 1 mL
EUR 388
Description: EBV P125 Protein, recombinant protein from E. coli.

Recombinant EBV P125 Protein

VAng-Lsx0119-25mL 25 mL
EUR 6099
Description: EBV P125 Protein, recombinant protein from E. coli.

Epstein-Barr Virus (HHV-4) EBNA1 Protein

  • EUR 1121.00
  • EUR 467.00
  • EUR 1970.00
  • 0.5 mg
  • 100 ug
  • 1 mg
  • Shipped within 5-10 working days.

Recombinant EBNA1 Protein [His] (1.185 mg/mL)

VAng-0610Lsx-inquire inquire Ask for price
Description: Epstein-Barr Virus (EBV) Nuclear Antigen-1 (EBNA-1), recombinant protein from E. coli. MW 63 kDa, 1.185 mg/mL.

Recombinant EBNA1 Protein [His] (1.25 mg/mL)

VAng-0611Lsx-inquire inquire Ask for price
Description: Epstein-Barr Virus (EBV) Nuclear Antigen-1 (EBNA-1), recombinant protein from E. coli. MW 63 kDa, 1.25 mg/mL.

EBNA1BP2 EBNA1 Binding Protein 2 Human Recombinant Protein

PROTQ99848 Regular: 20ug
EUR 317
Description: Recombinant Human EBNA1BP2 produced in E. coli is a single polypeptide chain containing 329 amino acids (1-306) and having a molecular mass of 37.2kDa.;EBNA1BP2 is fused to a 23 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.

EBV p18 protein (His tag)

80-1355S 100 ug
EUR 241
Description: Purified recombinant EBV p18 protein (His tag)

EBV p54 protein (His tag)

80-1361 1 mg
EUR 1083
Description: Purified recombinant EBV p54 protein (His tag)

EBV p138 protein (His tag)

80-1362 1 mg
EUR 1083
Description: Purified recombinant EBV p138 protein (His tag)

EBV HHV-4 p23 Protein

abx060518-1mg 1 mg
EUR 1887
  • Shipped within 5-10 working days.

EBV p54 (EA-D) Protein

abx061433-1mg 1 mg
EUR 1511
  • Shipped within 5-10 working days.

Inactivated EBV gp125 VCA Protein

VAng-Lsx04574-1mL 1 mL
EUR 353
Description: Epstein-Barr Virus (Strain P3HR1) gp125 VCA, inactivated antigen.

Inactivated EBV gp125 VCA Protein

VAng-Lsx04574-25mL 25 mL
EUR 6099
Description: Epstein-Barr Virus (Strain P3HR1) gp125 VCA, inactivated antigen.

Recombinant EBV P18 Mosaic Protein

VAng-Lsx0115-inquire inquire Ask for price
Description: EBV P18 Mosaic protein, recombinant protein from E. coli.

Recombinant EBV P23 Protein [His]

VAng-Lsx0117-inquire inquire Ask for price
Description: Recombinant EBV p23 protein was expressed in E. coli and purified by proprietary chromatographic technique, 17.7kDa.

Recombinant EBV BFRF3 Protein [GST]

VAng-Lsx0120-inquire inquire Ask for price
Description: BFRF3 (EBV) (P14348) partial recombinant protein with GST tag expressed in E. coli.

Recombinant EBV BMRF1 Protein [GST]

VAng-Lsx0121-inquire inquire Ask for price
Description: BMRF1 (EBV) (P03191) partial recombinant protein with GST tag expressed in E. coli.

Recombinant EBV P138 Protein [His]

VAng-0612Lsx-inquire inquire Ask for price
Description: EBV p138 Early Antigen D (EA-D) Protein, recombinant protein from E. coli. 1.00 mg/mL.

Recombinant EBV P54 Protein [His]

VAng-0613Lsx-inquire inquire Ask for price
Description: EBV p54 Early Antigen D (EA-D) Protein, recombinant protein from E. coli. 1.068 mg/mL.

Recombinant EBV P18 Protein [His]

VAng-0614Lsx-inquire inquire Ask for price
Description: EBV Viral Capsid Antigen (VCA) p18, recombinant protein from E. coli. 2.14 mg/mL.

Recombinant EBV p23 Protein [GST]

VAng-0617Lsx-inquire inquire Ask for price
Description: EBV p23, recombinant protein from E. coli. 1.00 mg/mL.

EBV antibody (VCA)

10-E40B 200 ug
EUR 229
Description: Mouse monoclonal EBV antibody (VCA)


DAG1849 500 ug
EUR 2529

EBV Glycoprotein 125

DAG3085 25 ml
EUR 1639

Recombinant EBV p18

DAGA-3074 100ug
EUR 1066

EBV LMP2A Antibody

abx021712-025mg 0.25 mg
EUR 1010
  • Shipped within 5-10 working days.

Inactivated EBV Antigen

VAng-Lsx0109-1mL 1 mL
EUR 1360
Description: EBV, natural antigen.

Epstein-Barr Virus (HHV-4) Mosaic EBNA1 Protein

  • EUR 885.00
  • EUR 342.00
  • EUR 1372.00
  • 0.5 mg
  • 100 ug
  • 1 mg
  • Shipped within 5-10 working days.

Human EBNA1 Binding Protein 2 (EBNA1BP2) ELISA Kit

abx384822-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Mouse EBNA1 Binding Protein 2 (EBNA1BP2) ELISA Kit

abx389130-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

The role of monoamine oxidase A in HPV-16 E7-induced epithelial-mesenchymal transition and HIF-1α protein accumulation in non-small cell lung cancer cells


Our previous studies have found that human papillomavirus (HPV)-16 E7 oncoprotein promotes epithelial-mesenchymal transition (EMT) and hypoxia-inducible factor-1α (HIF-1α) protein accumulation in non-small cell lung cancer (NSCLC) cells and monoamine oxidase A (MAOA) is highly expressed in NSCLC tissues.
Here, we further explored the role of MAOA in HPV-16 E7-induced EMT and HIF-1α protein accumulation in A549 and NCI-H460 NSCLC cells. Our results showed that HPV-16 E7 enhanced MAOA expression in NSCLC cells. Additionally, MAOA knockout inhibited HPV-16 E7-induced migration, invasion, and EMT, and significantly reduced HPV-16 E7-induced ROS generation and HIF-1α protein accumulation via promoting its degradation.
Furthermore, MAOA knockout suppressed HPV-16 E7-induced ERK1/2 activation. In vivo, MAOA knockout inhibited tumor growth, metastasis, and the expression of EMT-related markers and HIF-1α proteins induced by HPV-16 E7 in NCI-H460 NSCLC subcutaneous xenograft and in situ intrapulmonary models of nude mice. Taken together, our findings provide evidence that MAOA plays a key role in EMT and HIF-1α protein accumulation induced by HPV-16 E7 in NSCLC cells, suggesting that MAOA may be a potential therapeutic target for HPV-related NSCLC.
YF-PA27338 100 ul
EUR 403
Description: Rabbit polyclonal to PKN1
Human Protein Kinase N1 (PKN1) ELISA Kit
DLR-PKN1-Hu-48T 48T
EUR 479
  • Should the Human Protein Kinase N1 (PKN1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Protein Kinase N1 (PKN1) in samples from tissue homogenates, cell lysates or other biological fluids.
Human Protein Kinase N1 (PKN1) ELISA Kit
DLR-PKN1-Hu-96T 96T
EUR 621
  • Should the Human Protein Kinase N1 (PKN1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Protein Kinase N1 (PKN1) in samples from tissue homogenates, cell lysates or other biological fluids.
Human Protein Kinase N1 (PKN1) ELISA Kit
RDR-PKN1-Hu-48Tests 48 Tests
EUR 500
Human Protein Kinase N1 (PKN1) ELISA Kit
RDR-PKN1-Hu-96Tests 96 Tests
EUR 692
Human Protein Kinase N1 (PKN1) ELISA Kit
RD-PKN1-Hu-48Tests 48 Tests
EUR 478
Human Protein Kinase N1 (PKN1) ELISA Kit
RD-PKN1-Hu-96Tests 96 Tests
EUR 662
Rabbit Polyclonal antibody Anti-CRBN
Anti-CRBN 50 µg
EUR 349
Anti-PKN1 (1B10)
YF-MA14890 100 ug
EUR 363
Description: Mouse monoclonal to PKN1
Anti-PKN1 (1A4)
YF-MA14891 100 ug
EUR 363
Description: Mouse monoclonal to PKN1
PKN1 Antibody
48392-100ul 100ul
EUR 333
PKN1 Antibody
48392-50ul 50ul
EUR 239
PKN1 Antibody
DF4790 200ul
EUR 304
Description: PKN1 Antibody detects endogenous levels of total PKN1.
PKN1 Antibody
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against PKN1. Recognizes PKN1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/20000
PKN1 antibody
70R-50256 100 ul
EUR 244
Description: Purified Polyclonal PKN1 antibody
PKN1 Antibody
ABD4790 100 ug
EUR 438
PKN1/PRK1 Antibody
35295-100ul 100ul
EUR 252
PKN1/PRK1 Antibody
35295-50ul 50ul
EUR 187
PKN1 Conjugated Antibody
C48392 100ul
EUR 397
PKN1 Polyclonal Antibody
ABP59926-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human PKN1 protein at amino acid sequence of 720-800
  • Applications tips:
Description: A polyclonal antibody for detection of PKN1 from Human, Mouse, Rat. This PKN1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PKN1 protein at amino acid sequence of 720-800
PKN1 Polyclonal Antibody
ABP59926-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human PKN1 protein at amino acid sequence of 720-800
  • Applications tips:
Description: A polyclonal antibody for detection of PKN1 from Human, Mouse, Rat. This PKN1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PKN1 protein at amino acid sequence of 720-800
PKN1 Polyclonal Antibody
ABP59926-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human PKN1 protein at amino acid sequence of 720-800
  • Applications tips:
Description: A polyclonal antibody for detection of PKN1 from Human, Mouse, Rat. This PKN1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PKN1 protein at amino acid sequence of 720-800
PKN1 Polyclonal Antibody
ES8989-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against PKN1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA
PKN1 Polyclonal Antibody
ES8989-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against PKN1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA
Pkn1/ Rat Pkn1 ELISA Kit
ELI-37289r 96 Tests
EUR 886
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
PKN1/PRK1 Conjugated Antibody
C35295 100ul
EUR 397
Polyclonal Goat anti-GST α-form
GST-ANTI-1 50 uL
EUR 280
Polyclonal Goat anti-GST μ-form
GST-ANTI-2 50 uL
EUR 280
Polyclonal Goat anti-GST p-form
GST-ANTI-3 50 uL
EUR 280
PKN1 Rabbit pAb
A0553-100ul 100 ul
EUR 308
PKN1 Rabbit pAb
A0553-200ul 200 ul
EUR 459
PKN1 Rabbit pAb
A0553-20ul 20 ul
EUR 183
PKN1 Rabbit pAb
A0553-50ul 50 ul
EUR 223
PKN1 Blocking Peptide
DF4790-BP 1mg
EUR 195
PKN1 Blocking Peptide
  • EUR 272.00
  • EUR 411.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.
PKN1 cloning plasmid
CSB-CL623082HU-10ug 10ug
EUR 902
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2829
  • Sequence: atggccagcgacgccgtgcagagtgagcctcgcagctggtccctgctagagcagctgggcctggccggggcagacctggcggcccccggggtacagcagcagctggagctggagcgggagcggctgcggcgggaaatccgcaaggagctgaagctgaaggagggtgctgagaacc
  • Show more
Description: A cloning plasmid for the PKN1 gene.
Protein Kinase N1 (PKN1) Antibody
  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.
Protein Kinase N1 (PKN1) Antibody
  • EUR 300.00
  • EUR 133.00
  • EUR 746.00
  • EUR 398.00
  • EUR 258.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Protein Kinase N1 (PKN1) Antibody
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.
Protein Kinase N1 (PKN1) Antibody
  • EUR 787.00
  • EUR 411.00
  • 1 mg
  • 200 ug
  • Please enquire.
Monoclonal PKN1 Antibody, Clone: EPR3238
AMM07214G 0.1ml
EUR 528
Description: A Monoclonal antibody against Human PKN1. The antibodies are raised in Rabbit and are from clone EPR3238. This antibody is applicable in WB, FC
Monoclonal PKN1 Antibody, Clone: 4H10B1
AMM03009G 0.1ml
EUR 528
Description: A Monoclonal antibody against Human PKN1. The antibodies are raised in Mouse and are from clone 4H10B1. This antibody is applicable in WB and IHC, FC, ICC, E
Antibody for Human PKN1 (pThr774)
SPC-1065D 0.1ml
EUR 354
Description: A polyclonal antibody for PKN1 (pThr774) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Thr774 of human PKN1 (AA771-777). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This PKN1 (pThr774) antibody is unconjugated.
Antibody for Human PKN1 (pThr774)
SPC-1065D-A390 0.1ml
EUR 401
Description: A polyclonal antibody for PKN1 (pThr774) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Thr774 of human PKN1 (AA771-777). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This PKN1 (pThr774) antibody is conjugated to ATTO 390.
Antibody for Human PKN1 (pThr774)
SPC-1065D-A488 0.1ml
EUR 400
Description: A polyclonal antibody for PKN1 (pThr774) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Thr774 of human PKN1 (AA771-777). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This PKN1 (pThr774) antibody is conjugated to ATTO 488.
Antibody for Human PKN1 (pThr774)
SPC-1065D-A565 0.1ml
EUR 400
Description: A polyclonal antibody for PKN1 (pThr774) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Thr774 of human PKN1 (AA771-777). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This PKN1 (pThr774) antibody is conjugated to ATTO 565.
Antibody for Human PKN1 (pThr774)
SPC-1065D-A594 0.1ml
EUR 400
Description: A polyclonal antibody for PKN1 (pThr774) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Thr774 of human PKN1 (AA771-777). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This PKN1 (pThr774) antibody is conjugated to ATTO 594.
Antibody for Human PKN1 (pThr774)
SPC-1065D-A633 0.1ml
EUR 400
Description: A polyclonal antibody for PKN1 (pThr774) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Thr774 of human PKN1 (AA771-777). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This PKN1 (pThr774) antibody is conjugated to ATTO 633.
Antibody for Human PKN1 (pThr774)
SPC-1065D-A655 0.1ml
EUR 400
Description: A polyclonal antibody for PKN1 (pThr774) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Thr774 of human PKN1 (AA771-777). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This PKN1 (pThr774) antibody is conjugated to ATTO 655.
Antibody for Human PKN1 (pThr774)
SPC-1065D-A680 0.1ml
EUR 400
Description: A polyclonal antibody for PKN1 (pThr774) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Thr774 of human PKN1 (AA771-777). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This PKN1 (pThr774) antibody is conjugated to ATTO 680.
Antibody for Human PKN1 (pThr774)
SPC-1065D-A700 0.1ml
EUR 400
Description: A polyclonal antibody for PKN1 (pThr774) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Thr774 of human PKN1 (AA771-777). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This PKN1 (pThr774) antibody is conjugated to ATTO 700.
Antibody for Human PKN1 (pThr774)
SPC-1065D-ALP 0.1ml
EUR 394
Description: A polyclonal antibody for PKN1 (pThr774) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Thr774 of human PKN1 (AA771-777). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This PKN1 (pThr774) antibody is conjugated to Alkaline Phosphatase.
Antibody for Human PKN1 (pThr774)
SPC-1065D-APC 0.1ml
EUR 399
Description: A polyclonal antibody for PKN1 (pThr774) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Thr774 of human PKN1 (AA771-777). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This PKN1 (pThr774) antibody is conjugated to APC .
Antibody for Human PKN1 (pThr774)
SPC-1065D-APCCY7 0.1ml
EUR 471
Description: A polyclonal antibody for PKN1 (pThr774) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Thr774 of human PKN1 (AA771-777). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This PKN1 (pThr774) antibody is conjugated to APC/Cy7.
Antibody for Human PKN1 (pThr774)
SPC-1065D-BI 0.1ml
EUR 396
Description: A polyclonal antibody for PKN1 (pThr774) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Thr774 of human PKN1 (AA771-777). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This PKN1 (pThr774) antibody is conjugated to Biotin.
Antibody for Human PKN1 (pThr774)
SPC-1065D-DY350 0.1ml
EUR 475
Description: A polyclonal antibody for PKN1 (pThr774) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Thr774 of human PKN1 (AA771-777). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This PKN1 (pThr774) antibody is conjugated to Dylight 350.
Antibody for Human PKN1 (pThr774)
SPC-1065D-DY405 0.1ml
EUR 452
Description: A polyclonal antibody for PKN1 (pThr774) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Thr774 of human PKN1 (AA771-777). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This PKN1 (pThr774) antibody is conjugated to Dylight 405.
Antibody for Human PKN1 (pThr774)
SPC-1065D-DY488 0.1ml
EUR 432
Description: A polyclonal antibody for PKN1 (pThr774) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Thr774 of human PKN1 (AA771-777). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This PKN1 (pThr774) antibody is conjugated to Dylight 488.
Antibody for Human PKN1 (pThr774)
SPC-1065D-DY594 0.1ml
EUR 436
Description: A polyclonal antibody for PKN1 (pThr774) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Thr774 of human PKN1 (AA771-777). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This PKN1 (pThr774) antibody is conjugated to Dylight 594.
Antibody for Human PKN1 (pThr774)
SPC-1065D-DY633 0.1ml
EUR 426
Description: A polyclonal antibody for PKN1 (pThr774) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Thr774 of human PKN1 (AA771-777). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This PKN1 (pThr774) antibody is conjugated to Dylight 633.
Antibody for Human PKN1 (pThr774)
SPC-1065D-FITC 0.1ml
EUR 392
Description: A polyclonal antibody for PKN1 (pThr774) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Thr774 of human PKN1 (AA771-777). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This PKN1 (pThr774) antibody is conjugated to FITC.
Antibody for Human PKN1 (pThr774)
SPC-1065D-HRP 0.1ml
EUR 388
Description: A polyclonal antibody for PKN1 (pThr774) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Thr774 of human PKN1 (AA771-777). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This PKN1 (pThr774) antibody is conjugated to HRP.
Antibody for Human PKN1 (pThr774)
SPC-1065D-P594 0.1ml
EUR 407
Description: A polyclonal antibody for PKN1 (pThr774) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Thr774 of human PKN1 (AA771-777). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This PKN1 (pThr774) antibody is conjugated to PE/ATTO 594.
Antibody for Human PKN1 (pThr774)
SPC-1065D-PCP 0.1ml
EUR 399
Description: A polyclonal antibody for PKN1 (pThr774) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Thr774 of human PKN1 (AA771-777). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This PKN1 (pThr774) antibody is conjugated to PerCP.
Antibody for Human PKN1 (pThr774)
SPC-1065D-RPE 0.1ml
EUR 397
Description: A polyclonal antibody for PKN1 (pThr774) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Thr774 of human PKN1 (AA771-777). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This PKN1 (pThr774) antibody is conjugated to RPE .
Antibody for Human PKN1 (pThr774)
SPC-1065D-STR 0.1ml
EUR 398
Description: A polyclonal antibody for PKN1 (pThr774) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Thr774 of human PKN1 (AA771-777). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This PKN1 (pThr774) antibody is conjugated to Streptavidin.
Human PKN1 ELISA Kit
EHP0125 96Tests
EUR 521
Bovine PKN1 ELISA Kit
EBP0125 96Tests
EUR 521
Anserini PKN1 ELISA Kit
EAP0125 96Tests
EUR 521
Canine PKN1 ELISA Kit
ECP0125 96Tests
EUR 521
EGTP0125 96Tests
EUR 521
EF005461 96 Tests
EUR 689
Rat PKN1 shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Human PKN1 shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Mouse PKN1 shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Porcine PKN1 ELISA Kit
EPP0125 96Tests
EUR 521

Leave a Reply

Your email address will not be published. Required fields are marked *